Incidental Mutation 'R5347:Spen'
ID422662
Institutional Source Beutler Lab
Gene Symbol Spen
Ensembl Gene ENSMUSG00000040761
Gene Namespen family transcription repressor
SynonymsMint
MMRRC Submission 042926-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5347 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location141467890-141538597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141471485 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 3254 (E3254V)
Ref Sequence ENSEMBL: ENSMUSP00000077925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006377] [ENSMUST00000078886] [ENSMUST00000105786]
Predicted Effect probably benign
Transcript: ENSMUST00000006377
SMART Domains Protein: ENSMUSP00000006377
Gene: ENSMUSG00000006215

DomainStartEndE-ValueType
BTB 24 116 1.38e-27 SMART
low complexity region 203 222 N/A INTRINSIC
ZnF_C2H2 297 319 6.42e-4 SMART
ZnF_C2H2 325 347 3.11e-2 SMART
ZnF_C2H2 353 375 2.49e-1 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 8.47e-4 SMART
ZnF_C2H2 437 459 1.22e-4 SMART
ZnF_C2H2 465 487 4.94e-5 SMART
ZnF_C2H2 493 515 3.26e-5 SMART
ZnF_C2H2 521 543 7.26e-3 SMART
ZnF_C2H2 549 571 4.79e-3 SMART
ZnF_C2H2 577 599 1.58e-3 SMART
ZnF_C2H2 605 628 2.57e-3 SMART
low complexity region 654 674 N/A INTRINSIC
ZnF_C2H2 708 730 4.4e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078886
AA Change: E3254V

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761
AA Change: E3254V

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 617 632 N/A INTRINSIC
low complexity region 669 691 N/A INTRINSIC
low complexity region 695 720 N/A INTRINSIC
low complexity region 749 773 N/A INTRINSIC
coiled coil region 800 825 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
internal_repeat_2 844 954 6.27e-5 PROSPERO
coiled coil region 1494 1522 N/A INTRINSIC
low complexity region 1587 1627 N/A INTRINSIC
low complexity region 1635 1641 N/A INTRINSIC
low complexity region 1642 1671 N/A INTRINSIC
low complexity region 1747 1758 N/A INTRINSIC
low complexity region 1810 1823 N/A INTRINSIC
low complexity region 1888 1903 N/A INTRINSIC
low complexity region 1940 1955 N/A INTRINSIC
low complexity region 2003 2012 N/A INTRINSIC
internal_repeat_2 2015 2115 6.27e-5 PROSPERO
low complexity region 2127 2147 N/A INTRINSIC
low complexity region 2169 2191 N/A INTRINSIC
low complexity region 2207 2219 N/A INTRINSIC
low complexity region 2304 2323 N/A INTRINSIC
low complexity region 2332 2371 N/A INTRINSIC
low complexity region 2396 2413 N/A INTRINSIC
low complexity region 2518 2533 N/A INTRINSIC
low complexity region 2545 2555 N/A INTRINSIC
low complexity region 2696 2722 N/A INTRINSIC
low complexity region 2931 2942 N/A INTRINSIC
low complexity region 2994 3006 N/A INTRINSIC
low complexity region 3192 3212 N/A INTRINSIC
low complexity region 3299 3337 N/A INTRINSIC
Pfam:SPOC 3465 3586 2.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105786
AA Change: E3277V

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761
AA Change: E3277V

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 692 714 N/A INTRINSIC
low complexity region 718 743 N/A INTRINSIC
low complexity region 772 796 N/A INTRINSIC
coiled coil region 823 848 N/A INTRINSIC
low complexity region 853 864 N/A INTRINSIC
internal_repeat_2 867 977 8.58e-5 PROSPERO
coiled coil region 1517 1545 N/A INTRINSIC
low complexity region 1610 1650 N/A INTRINSIC
low complexity region 1658 1664 N/A INTRINSIC
low complexity region 1665 1694 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1833 1846 N/A INTRINSIC
low complexity region 1911 1926 N/A INTRINSIC
low complexity region 1963 1978 N/A INTRINSIC
low complexity region 2026 2035 N/A INTRINSIC
internal_repeat_2 2038 2138 8.58e-5 PROSPERO
low complexity region 2150 2170 N/A INTRINSIC
low complexity region 2192 2214 N/A INTRINSIC
low complexity region 2230 2242 N/A INTRINSIC
low complexity region 2327 2346 N/A INTRINSIC
low complexity region 2355 2394 N/A INTRINSIC
low complexity region 2419 2436 N/A INTRINSIC
low complexity region 2541 2556 N/A INTRINSIC
low complexity region 2568 2578 N/A INTRINSIC
low complexity region 2719 2745 N/A INTRINSIC
low complexity region 2954 2965 N/A INTRINSIC
low complexity region 3017 3029 N/A INTRINSIC
low complexity region 3215 3235 N/A INTRINSIC
low complexity region 3322 3360 N/A INTRINSIC
Pfam:SPOC 3488 3609 2.7e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147227
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hormone inducible transcriptional repressor. Repression of transcription by this gene product can occur through interactions with other repressors, by the recruitment of proteins involved in histone deacetylation, or through sequestration of transcriptional activators. The product of this gene contains a carboxy-terminal domain that permits binding to other corepressor proteins. This domain also permits interaction with members of the NuRD complex, a nucleosome remodeling protein complex that contains deacetylase activity. In addition, this repressor contains several RNA recognition motifs that confer binding to a steroid receptor RNA coactivator; this binding can modulate the activity of both liganded and nonliganded steroid receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during late gestation exhibiting morphological abnormalities of the heart, pancreas, and liver. Inactivation of this gene also affects the differentiation of B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a A G 2: 48,892,154 Y233C probably damaging Het
Agl A G 3: 116,791,165 S169P probably damaging Het
Arid1b C T 17: 5,291,057 Q879* probably null Het
Bbs2 A G 8: 94,092,550 S64P probably damaging Het
BC027072 A G 17: 71,749,935 S916P probably benign Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Cacna2d2 A G 9: 107,514,114 T447A probably benign Het
Ccdc169 A T 3: 55,142,319 probably benign Het
Cdan1 A G 2: 120,730,065 S275P possibly damaging Het
Cdh15 A G 8: 122,862,063 N292S probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cnnm1 A G 19: 43,441,862 H473R probably benign Het
Cplx4 G A 18: 65,970,086 probably benign Het
Crb1 C T 1: 139,337,371 G103E probably damaging Het
Diexf A T 1: 193,128,379 D105E probably benign Het
Dnaja3 T A 16: 4,694,482 V250E possibly damaging Het
Dync2h1 T G 9: 7,129,727 Q1757P probably damaging Het
Edem3 A G 1: 151,807,451 Q626R probably damaging Het
Eif2b1 T C 5: 124,578,799 probably benign Het
Esf1 T A 2: 140,154,881 K521* probably null Het
Fam160b1 A G 19: 57,378,619 D198G probably benign Het
Fbxl3 A C 14: 103,083,294 V239G probably damaging Het
Fto A G 8: 91,391,479 probably benign Het
Gm5773 T C 3: 93,773,783 L254P probably damaging Het
Gm5916 A T 9: 36,120,716 W91R probably benign Het
Gm8251 T A 1: 44,057,795 Y1381F probably benign Het
Gpam A T 19: 55,088,837 L174H probably damaging Het
Grk1 G A 8: 13,414,478 R450Q probably damaging Het
Hc G A 2: 35,037,624 A326V probably benign Het
Hectd4 T C 5: 121,304,448 I1317T probably benign Het
Hlcs A G 16: 94,267,524 V426A possibly damaging Het
Ighv1-23 T C 12: 114,764,756 probably benign Het
Itgax G A 7: 128,141,302 V754I probably benign Het
Krt24 T A 11: 99,282,730 D255V probably damaging Het
Lnpk T C 2: 74,573,591 probably benign Het
Loxhd1 G T 18: 77,366,541 R478L probably damaging Het
Lrrc56 A G 7: 141,209,624 Q518R probably benign Het
Mbl1 A T 14: 41,158,829 I225F probably damaging Het
Mmp21 T C 7: 133,675,922 S392G probably benign Het
Mug2 T G 6: 122,081,592 F1318V probably damaging Het
Myo5c A G 9: 75,295,205 N1447S probably null Het
Nbea A C 3: 56,040,876 V543G probably damaging Het
Necap1 A G 6: 122,880,747 I96V probably benign Het
Nr3c2 T A 8: 77,210,748 M872K possibly damaging Het
Nrf1 C T 6: 30,118,968 T362M probably benign Het
Olfr113 T C 17: 37,574,727 E232G probably damaging Het
Plekhm3 T C 1: 64,819,990 E685G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sbk3 A T 7: 4,967,423 S316T probably benign Het
Serpinb9e T C 13: 33,257,784 L233P probably damaging Het
Set T A 2: 30,069,410 S132T possibly damaging Het
Slc17a4 C T 13: 23,908,817 E11K possibly damaging Het
Slc22a6 T A 19: 8,618,553 N86K possibly damaging Het
Slco1a6 A G 6: 142,086,599 L600P probably damaging Het
Sp8 A G 12: 118,848,511 K34E possibly damaging Het
Tcf12 G A 9: 71,885,243 P53S probably damaging Het
Tcf3 A G 10: 80,410,211 V626A probably damaging Het
Trpc4ap A G 2: 155,672,988 probably null Het
Ttc3 T A 16: 94,429,620 V892D probably damaging Het
Tub G T 7: 109,026,771 R243L possibly damaging Het
Tubgcp5 A G 7: 55,823,685 Y837C probably damaging Het
Wdhd1 A T 14: 47,268,724 Y244* probably null Het
Xdh T A 17: 73,925,032 T228S probably benign Het
Zfp418 A C 7: 7,182,535 Q499P probably benign Het
Zfpm1 G A 8: 122,335,530 E443K possibly damaging Het
Zfy1 T C Y: 725,950 H605R possibly damaging Het
Other mutations in Spen
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Spen APN 4 141489901 missense unknown
IGL01357:Spen APN 4 141517113 missense unknown
IGL02184:Spen APN 4 141487606 missense unknown
IGL02226:Spen APN 4 141478146 missense unknown
IGL02321:Spen APN 4 141517130 missense unknown
IGL02350:Spen APN 4 141477579 missense unknown
IGL02357:Spen APN 4 141477579 missense unknown
IGL02627:Spen APN 4 141473015 missense probably damaging 0.99
IGL02683:Spen APN 4 141471645 missense probably benign 0.06
IGL02945:Spen APN 4 141494313 missense unknown
IGL02950:Spen APN 4 141469508 missense probably damaging 1.00
IGL03008:Spen APN 4 141476137 missense possibly damaging 0.70
IGL03019:Spen APN 4 141478916 missense unknown
IGL03038:Spen APN 4 141538239 missense unknown
IGL03334:Spen APN 4 141469969 missense probably damaging 1.00
R0105:Spen UTSW 4 141469810 splice site probably benign
R0268:Spen UTSW 4 141477557 missense unknown
R0359:Spen UTSW 4 141516870 missense unknown
R0394:Spen UTSW 4 141474203 missense probably benign 0.03
R0423:Spen UTSW 4 141479336 missense unknown
R0433:Spen UTSW 4 141483758 missense unknown
R0462:Spen UTSW 4 141473651 missense probably damaging 1.00
R0687:Spen UTSW 4 141488028 missense unknown
R0699:Spen UTSW 4 141474391 missense possibly damaging 0.72
R0865:Spen UTSW 4 141471870 missense probably benign 0.11
R0918:Spen UTSW 4 141485564 missense unknown
R1034:Spen UTSW 4 141475752 missense probably benign 0.33
R1341:Spen UTSW 4 141469400 missense possibly damaging 0.78
R1401:Spen UTSW 4 141471821 missense probably damaging 0.98
R1509:Spen UTSW 4 141475635 missense probably benign 0.00
R1509:Spen UTSW 4 141475700 missense possibly damaging 0.53
R1561:Spen UTSW 4 141472383 nonsense probably null
R1589:Spen UTSW 4 141488024 missense unknown
R1640:Spen UTSW 4 141468943 missense probably damaging 0.98
R1758:Spen UTSW 4 141476375 missense unknown
R1764:Spen UTSW 4 141472950 missense probably damaging 1.00
R1824:Spen UTSW 4 141472785 missense probably damaging 1.00
R1899:Spen UTSW 4 141470343 missense probably benign 0.17
R1916:Spen UTSW 4 141472598 missense probably damaging 1.00
R2011:Spen UTSW 4 141473329 missense probably damaging 1.00
R2295:Spen UTSW 4 141477273 missense unknown
R2379:Spen UTSW 4 141516927 missense unknown
R2404:Spen UTSW 4 141477905 missense unknown
R3719:Spen UTSW 4 141517183 missense unknown
R3889:Spen UTSW 4 141477881 missense unknown
R3945:Spen UTSW 4 141477353 missense unknown
R4227:Spen UTSW 4 141522147 missense unknown
R4326:Spen UTSW 4 141477372 missense unknown
R4382:Spen UTSW 4 141473139 missense possibly damaging 0.88
R4542:Spen UTSW 4 141476786 missense unknown
R4757:Spen UTSW 4 141473079 nonsense probably null
R4771:Spen UTSW 4 141472596 missense probably benign 0.14
R5072:Spen UTSW 4 141522302 missense unknown
R5121:Spen UTSW 4 141476099 missense probably benign 0.00
R5176:Spen UTSW 4 141476276 missense unknown
R5290:Spen UTSW 4 141473816 missense probably damaging 1.00
R5291:Spen UTSW 4 141488079 missense unknown
R5293:Spen UTSW 4 141472406 missense possibly damaging 0.89
R5511:Spen UTSW 4 141475064 missense possibly damaging 0.86
R5511:Spen UTSW 4 141516838 missense unknown
R5772:Spen UTSW 4 141478184 missense unknown
R5834:Spen UTSW 4 141471843 missense possibly damaging 0.63
R5858:Spen UTSW 4 141473871 missense probably benign 0.05
R6214:Spen UTSW 4 141479112 missense unknown
R6232:Spen UTSW 4 141517022 missense unknown
R6345:Spen UTSW 4 141471633 missense possibly damaging 0.86
R6419:Spen UTSW 4 141476310 missense unknown
R6455:Spen UTSW 4 141475509 missense probably damaging 0.97
R6979:Spen UTSW 4 141478063 missense unknown
T0722:Spen UTSW 4 141474353 missense probably benign 0.33
T0975:Spen UTSW 4 141474353 missense probably benign 0.33
Z1088:Spen UTSW 4 141477976 missense unknown
Z1088:Spen UTSW 4 141477977 missense unknown
Predicted Primers PCR Primer
(F):5'- TTAAACCACAGTGCCCCTAGG -3'
(R):5'- ATCCACATGTGACTGCTGTC -3'

Sequencing Primer
(F):5'- CCTAGGTGTGTGCCCAAAGGTAG -3'
(R):5'- GCGGTTAAGACTTCAGATGCC -3'
Posted On2016-08-04