Incidental Mutation 'R5347:Cacna2d2'
ID422690
Institutional Source Beutler Lab
Gene Symbol Cacna2d2
Ensembl Gene ENSMUSG00000010066
Gene Namecalcium channel, voltage-dependent, alpha 2/delta subunit 2
Synonymsa2d2
MMRRC Submission 042926-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.837) question?
Stock #R5347 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location107399612-107529343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107514114 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 447 (T447A)
Ref Sequence ENSEMBL: ENSMUSP00000125943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010210] [ENSMUST00000085092] [ENSMUST00000164988] [ENSMUST00000166799] [ENSMUST00000168532] [ENSMUST00000170737]
Predicted Effect probably benign
Transcript: ENSMUST00000010210
AA Change: T447A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000010210
Gene: ENSMUSG00000010066
AA Change: T447A

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 9.9e-32 PFAM
Pfam:VGCC_alpha2 583 673 1.8e-33 PFAM
low complexity region 968 977 N/A INTRINSIC
low complexity region 1114 1137 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085092
AA Change: T447A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082173
Gene: ENSMUSG00000010066
AA Change: T447A

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 676 5.8e-35 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164988
AA Change: T447A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130451
Gene: ENSMUSG00000010066
AA Change: T447A

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 6.7e-49 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 2.4e-31 PFAM
Pfam:VGCC_alpha2 583 675 2.5e-34 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166799
AA Change: T447A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126029
Gene: ENSMUSG00000010066
AA Change: T447A

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 8.5e-44 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 576 1.3e-32 PFAM
Pfam:VGCC_alpha2 583 675 1.4e-47 PFAM
low complexity region 975 984 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168532
AA Change: T447A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132512
Gene: ENSMUSG00000010066
AA Change: T447A

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2.1e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 676 5.8e-35 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1122 1145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169354
Predicted Effect probably benign
Transcript: ENSMUST00000170737
AA Change: T447A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125943
Gene: ENSMUSG00000010066
AA Change: T447A

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 673 1.9e-33 PFAM
low complexity region 968 977 N/A INTRINSIC
low complexity region 1116 1139 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171809
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium channels mediate the entry of calcium ions into the cell upon membrane polarization. This gene encodes the alpha-2/delta subunit of the voltage-dependent calcium channel complex. The complex consists of the main channel-forming subunit alpha-1, and auxiliary subunits alpha-2/delta, beta, and gamma. The auxiliary subunits function in the assembly and membrane localization of the complex, and modulate calcium currents and channel activation/inactivation kinetics. The subunit encoded by this gene undergoes post-translational cleavage to yield the extracellular alpha2 peptide and a membrane-anchored delta polypeptide. This subunit is a receptor for the antiepileptic drug, gabapentin. Mutations in this gene are associated with early infantile epileptic encephalopathy. Single nucleotide polymorphisms in this gene are correlated with increased sensitivity to opioid drugs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for different mutant alleles show variable movement abnormalities including waddling, reeling or very slow gait, ataxia, and mild spike-wave seizures. While gross CNS abnormalities and demyelination are present in some mutant lines, they are not observed in others. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a A G 2: 48,892,154 Y233C probably damaging Het
Agl A G 3: 116,791,165 S169P probably damaging Het
Arid1b C T 17: 5,291,057 Q879* probably null Het
Bbs2 A G 8: 94,092,550 S64P probably damaging Het
BC027072 A G 17: 71,749,935 S916P probably benign Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Ccdc169 A T 3: 55,142,319 probably benign Het
Cdan1 A G 2: 120,730,065 S275P possibly damaging Het
Cdh15 A G 8: 122,862,063 N292S probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cnnm1 A G 19: 43,441,862 H473R probably benign Het
Cplx4 G A 18: 65,970,086 probably benign Het
Crb1 C T 1: 139,337,371 G103E probably damaging Het
Diexf A T 1: 193,128,379 D105E probably benign Het
Dnaja3 T A 16: 4,694,482 V250E possibly damaging Het
Dync2h1 T G 9: 7,129,727 Q1757P probably damaging Het
Edem3 A G 1: 151,807,451 Q626R probably damaging Het
Eif2b1 T C 5: 124,578,799 probably benign Het
Esf1 T A 2: 140,154,881 K521* probably null Het
Fam160b1 A G 19: 57,378,619 D198G probably benign Het
Fbxl3 A C 14: 103,083,294 V239G probably damaging Het
Fto A G 8: 91,391,479 probably benign Het
Gm5773 T C 3: 93,773,783 L254P probably damaging Het
Gm5916 A T 9: 36,120,716 W91R probably benign Het
Gm8251 T A 1: 44,057,795 Y1381F probably benign Het
Gpam A T 19: 55,088,837 L174H probably damaging Het
Grk1 G A 8: 13,414,478 R450Q probably damaging Het
Hc G A 2: 35,037,624 A326V probably benign Het
Hectd4 T C 5: 121,304,448 I1317T probably benign Het
Hlcs A G 16: 94,267,524 V426A possibly damaging Het
Ighv1-23 T C 12: 114,764,756 probably benign Het
Itgax G A 7: 128,141,302 V754I probably benign Het
Krt24 T A 11: 99,282,730 D255V probably damaging Het
Lnpk T C 2: 74,573,591 probably benign Het
Loxhd1 G T 18: 77,366,541 R478L probably damaging Het
Lrrc56 A G 7: 141,209,624 Q518R probably benign Het
Mbl1 A T 14: 41,158,829 I225F probably damaging Het
Mmp21 T C 7: 133,675,922 S392G probably benign Het
Mug2 T G 6: 122,081,592 F1318V probably damaging Het
Myo5c A G 9: 75,295,205 N1447S probably null Het
Nbea A C 3: 56,040,876 V543G probably damaging Het
Necap1 A G 6: 122,880,747 I96V probably benign Het
Nr3c2 T A 8: 77,210,748 M872K possibly damaging Het
Nrf1 C T 6: 30,118,968 T362M probably benign Het
Olfr113 T C 17: 37,574,727 E232G probably damaging Het
Plekhm3 T C 1: 64,819,990 E685G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sbk3 A T 7: 4,967,423 S316T probably benign Het
Serpinb9e T C 13: 33,257,784 L233P probably damaging Het
Set T A 2: 30,069,410 S132T possibly damaging Het
Slc17a4 C T 13: 23,908,817 E11K possibly damaging Het
Slc22a6 T A 19: 8,618,553 N86K possibly damaging Het
Slco1a6 A G 6: 142,086,599 L600P probably damaging Het
Sp8 A G 12: 118,848,511 K34E possibly damaging Het
Spen T A 4: 141,471,485 E3254V probably benign Het
Tcf12 G A 9: 71,885,243 P53S probably damaging Het
Tcf3 A G 10: 80,410,211 V626A probably damaging Het
Trpc4ap A G 2: 155,672,988 probably null Het
Ttc3 T A 16: 94,429,620 V892D probably damaging Het
Tub G T 7: 109,026,771 R243L possibly damaging Het
Tubgcp5 A G 7: 55,823,685 Y837C probably damaging Het
Wdhd1 A T 14: 47,268,724 Y244* probably null Het
Xdh T A 17: 73,925,032 T228S probably benign Het
Zfp418 A C 7: 7,182,535 Q499P probably benign Het
Zfpm1 G A 8: 122,335,530 E443K possibly damaging Het
Zfy1 T C Y: 725,950 H605R possibly damaging Het
Other mutations in Cacna2d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Cacna2d2 APN 9 107514873 missense probably damaging 1.00
IGL00425:Cacna2d2 APN 9 107527351 missense probably damaging 1.00
IGL01294:Cacna2d2 APN 9 107514081 missense probably damaging 1.00
IGL01969:Cacna2d2 APN 9 107509216 missense probably benign
IGL01974:Cacna2d2 APN 9 107517422 missense probably benign 0.00
IGL02001:Cacna2d2 APN 9 107522116 missense probably benign
IGL02125:Cacna2d2 APN 9 107513904 nonsense probably null
IGL02143:Cacna2d2 APN 9 107518275 splice site probably null
IGL02150:Cacna2d2 APN 9 107527316 splice site probably benign
IGL02213:Cacna2d2 APN 9 107514048 missense probably damaging 1.00
IGL02220:Cacna2d2 APN 9 107514879 missense probably damaging 1.00
IGL02238:Cacna2d2 APN 9 107513558 missense probably damaging 0.99
IGL02466:Cacna2d2 APN 9 107465554 missense probably damaging 1.00
IGL02569:Cacna2d2 APN 9 107514046 missense probably damaging 0.99
IGL02571:Cacna2d2 APN 9 107525646 missense possibly damaging 0.93
IGL02825:Cacna2d2 APN 9 107524460 missense probably damaging 1.00
IGL03000:Cacna2d2 APN 9 107524198 splice site probably null
IGL03064:Cacna2d2 APN 9 107509275 missense probably damaging 1.00
Blow UTSW 9 107513606 missense probably null 0.90
hera UTSW 9 107513280 missense probably damaging 1.00
PIT4131001:Cacna2d2 UTSW 9 107524668 missense probably damaging 1.00
R0233:Cacna2d2 UTSW 9 107514670 missense probably damaging 0.96
R0233:Cacna2d2 UTSW 9 107514670 missense probably damaging 0.96
R0387:Cacna2d2 UTSW 9 107513881 missense probably damaging 1.00
R0410:Cacna2d2 UTSW 9 107524620 missense probably damaging 1.00
R0538:Cacna2d2 UTSW 9 107524383 splice site probably benign
R0545:Cacna2d2 UTSW 9 107525223 missense probably damaging 1.00
R0729:Cacna2d2 UTSW 9 107517257 missense probably benign 0.06
R1024:Cacna2d2 UTSW 9 107527050 critical splice donor site probably null
R1538:Cacna2d2 UTSW 9 107517416 missense probably damaging 1.00
R1750:Cacna2d2 UTSW 9 107524644 missense probably damaging 1.00
R1774:Cacna2d2 UTSW 9 107526151 missense probably benign 0.19
R1800:Cacna2d2 UTSW 9 107527433 missense possibly damaging 0.46
R1873:Cacna2d2 UTSW 9 107513872 missense probably damaging 0.98
R1935:Cacna2d2 UTSW 9 107509256 missense probably damaging 1.00
R1936:Cacna2d2 UTSW 9 107509256 missense probably damaging 1.00
R1971:Cacna2d2 UTSW 9 107512006 missense probably damaging 0.98
R2095:Cacna2d2 UTSW 9 107527165 missense probably benign 0.05
R2135:Cacna2d2 UTSW 9 107526513 missense possibly damaging 0.74
R2197:Cacna2d2 UTSW 9 107527403 missense probably damaging 0.97
R2266:Cacna2d2 UTSW 9 107513280 missense probably damaging 1.00
R2483:Cacna2d2 UTSW 9 107512022 missense probably damaging 1.00
R4021:Cacna2d2 UTSW 9 107514058 missense probably damaging 1.00
R4392:Cacna2d2 UTSW 9 107400280 missense possibly damaging 0.47
R4629:Cacna2d2 UTSW 9 107527322 missense probably damaging 1.00
R5053:Cacna2d2 UTSW 9 107514864 missense probably damaging 1.00
R5327:Cacna2d2 UTSW 9 107513606 missense probably null 0.90
R5719:Cacna2d2 UTSW 9 107524652 missense probably benign 0.36
R5737:Cacna2d2 UTSW 9 107526747 missense possibly damaging 0.70
R5739:Cacna2d2 UTSW 9 107512329 missense probably benign 0.37
R6037:Cacna2d2 UTSW 9 107513539 missense probably damaging 1.00
R6037:Cacna2d2 UTSW 9 107513539 missense probably damaging 1.00
R6084:Cacna2d2 UTSW 9 107497521 critical splice donor site probably null
R6170:Cacna2d2 UTSW 9 107527334 missense probably damaging 1.00
R6254:Cacna2d2 UTSW 9 107509216 missense probably benign
R6427:Cacna2d2 UTSW 9 107515442 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- ACAATTGGCCCAATCGGACG -3'
(R):5'- CGTGAGTTTTACCCAATCAATCAAC -3'

Sequencing Primer
(F):5'- AATCGGACGGTGAGCCTCAG -3'
(R):5'- TTTACCCAATCAATCAACAGAGATGG -3'
Posted On2016-08-04