Incidental Mutation 'R5348:Olfml2b'
ID422717
Institutional Source Beutler Lab
Gene Symbol Olfml2b
Ensembl Gene ENSMUSG00000038463
Gene Nameolfactomedin-like 2B
Synonymsphotomedin-2, 1110018N05Rik, 4832415H08Rik
MMRRC Submission 042927-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R5348 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location170644532-170682789 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 170662426 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 205 (E205G)
Ref Sequence ENSEMBL: ENSMUSP00000047291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046792]
Predicted Effect probably benign
Transcript: ENSMUST00000046792
AA Change: E205G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000047291
Gene: ENSMUSG00000038463
AA Change: E205G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 41 68 N/A INTRINSIC
coiled coil region 179 213 N/A INTRINSIC
low complexity region 233 238 N/A INTRINSIC
Blast:OLF 254 306 1e-6 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 343 382 N/A INTRINSIC
OLF 492 746 4.76e-61 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an olfactomedin domain-containing protein. Most olfactomedin domain-containing proteins are secreted glycoproteins. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,048,146 E1331G probably damaging Het
Abcg5 A T 17: 84,671,206 C275S possibly damaging Het
Cdk12 T A 11: 98,204,292 S309T probably benign Het
Cep295nl T C 11: 118,333,599 R140G probably damaging Het
Chd8 A G 14: 52,232,698 V485A probably damaging Het
Chn2 A G 6: 54,300,218 I279V probably damaging Het
Cux2 A G 5: 121,865,978 S1032P probably damaging Het
Ddx55 T A 5: 124,554,565 M44K probably damaging Het
Dpyd T A 3: 118,781,943 H143Q probably benign Het
Fbxo10 A G 4: 45,058,934 W268R probably damaging Het
Gmfg A G 7: 28,446,394 D86G probably benign Het
Gpd1 T C 15: 99,722,140 V273A possibly damaging Het
Grhpr T C 4: 44,985,393 I158T probably damaging Het
Itpr2 A G 6: 146,476,693 F53L possibly damaging Het
Kctd21 A G 7: 97,347,970 I217V probably benign Het
Lrfn2 A G 17: 49,096,690 T614A probably benign Het
Lrrc7 T A 3: 158,175,326 D491V probably benign Het
Myo7b T C 18: 31,983,919 E916G probably damaging Het
Nf1 C T 11: 79,564,899 T550I probably damaging Het
Nsd1 A G 13: 55,312,334 T2125A probably benign Het
Olfr1084 A T 2: 86,638,806 L301I probably benign Het
Papolb T C 5: 142,529,217 T224A possibly damaging Het
Pcnx2 T C 8: 125,818,756 E1172G probably damaging Het
Ppip5k2 A G 1: 97,747,592 L362S possibly damaging Het
Ppp1r9b T A 11: 94,996,612 Y59* probably null Het
Pramef8 T C 4: 143,416,781 L39P probably damaging Het
Rapgef5 T A 12: 117,688,611 S76R probably benign Het
Rnh1 A T 7: 141,163,408 V218D probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Slc4a7 G T 14: 14,786,310 V999L probably benign Het
Slco4c1 A T 1: 96,842,529 I270N probably damaging Het
Tdp1 A G 12: 99,915,506 Y498C probably damaging Het
Tfip11 A G 5: 112,335,668 S650G probably benign Het
Ttn T C 2: 76,778,294 T17793A possibly damaging Het
Ulk2 T C 11: 61,783,613 T856A probably benign Het
Vps13d C T 4: 145,065,889 G3726E probably damaging Het
Other mutations in Olfml2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Olfml2b APN 1 170669066 missense probably damaging 0.96
IGL01871:Olfml2b APN 1 170662355 splice site probably benign
IGL02475:Olfml2b APN 1 170682174 missense probably damaging 1.00
IGL02657:Olfml2b APN 1 170681076 missense probably benign 0.00
IGL03375:Olfml2b APN 1 170649832 missense probably benign 0.35
PIT4280001:Olfml2b UTSW 1 170647736 missense probably damaging 1.00
R0040:Olfml2b UTSW 1 170668751 missense probably benign 0.00
R0194:Olfml2b UTSW 1 170681115 missense possibly damaging 0.89
R0834:Olfml2b UTSW 1 170647844 missense probably benign 0.00
R1218:Olfml2b UTSW 1 170649782 missense probably damaging 1.00
R1386:Olfml2b UTSW 1 170681162 missense probably damaging 0.97
R1420:Olfml2b UTSW 1 170669027 missense probably benign 0.01
R1699:Olfml2b UTSW 1 170645073 missense possibly damaging 0.89
R1730:Olfml2b UTSW 1 170681789 missense probably damaging 1.00
R1755:Olfml2b UTSW 1 170681777 missense probably damaging 1.00
R1869:Olfml2b UTSW 1 170669243 missense probably damaging 0.96
R2295:Olfml2b UTSW 1 170662538 splice site probably benign
R2394:Olfml2b UTSW 1 170649750 missense possibly damaging 0.82
R3784:Olfml2b UTSW 1 170681982 missense probably damaging 0.96
R4523:Olfml2b UTSW 1 170669222 missense probably benign
R4611:Olfml2b UTSW 1 170644947 missense probably damaging 0.99
R4900:Olfml2b UTSW 1 170662378 missense probably damaging 1.00
R5201:Olfml2b UTSW 1 170668864 missense probably benign
R5245:Olfml2b UTSW 1 170668874 missense probably benign
R5268:Olfml2b UTSW 1 170649761 missense probably damaging 1.00
R5283:Olfml2b UTSW 1 170681189 nonsense probably null
R5408:Olfml2b UTSW 1 170644976 missense probably damaging 1.00
R5673:Olfml2b UTSW 1 170682129 missense probably damaging 1.00
R5758:Olfml2b UTSW 1 170669264 critical splice donor site probably null
R5893:Olfml2b UTSW 1 170662473 missense probably benign
R6290:Olfml2b UTSW 1 170649790 nonsense probably null
R6380:Olfml2b UTSW 1 170669231 missense probably benign 0.00
R6778:Olfml2b UTSW 1 170645070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAATCTCCATGCTCCAAG -3'
(R):5'- GACACAGAACTGAGACCCTG -3'

Sequencing Primer
(F):5'- TGCTCCAAGCCACCCTG -3'
(R):5'- AGAACTGAGACCCTGGCCTTG -3'
Posted On2016-08-04