Incidental Mutation 'R5348:Abcg5'
ID422753
Institutional Source Beutler Lab
Gene Symbol Abcg5
Ensembl Gene ENSMUSG00000040505
Gene NameATP binding cassette subfamily G member 5
SynonymsSterolin-1, cmp, trac
MMRRC Submission 042927-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R5348 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location84658234-84683011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84671206 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 275 (C275S)
Ref Sequence ENSEMBL: ENSMUSP00000069495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066175] [ENSMUST00000163375]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066175
AA Change: C275S

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069495
Gene: ENSMUSG00000040505
AA Change: C275S

DomainStartEndE-ValueType
AAA 79 271 2.28e-11 SMART
Pfam:ABC2_membrane 367 581 1.3e-24 PFAM
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163375
SMART Domains Protein: ENSMUSP00000130783
Gene: ENSMUSG00000040505

DomainStartEndE-ValueType
Pfam:ABC_tran 1 134 7.8e-17 PFAM
Pfam:ABC2_membrane 195 409 1.4e-23 PFAM
transmembrane domain 449 471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172439
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily, and functions as a half-transporter to limit intestinal absorption and promote biliary excretion of sterols. Disruption of this gene in mice results in thrombocytopenia, prolonged bleeding times, anemia, leukopenia, infertility, shortened life span and cardiomyopathy. Mice lacking this gene show symptoms of sitosterolemia. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes for a null allele show hyperabsorption of dietary plant sterols and sitosterolemia. Spontaneous mutants are small, infertile and hunched and display anemia, leukopenia, macrothrombocytopenia, other hematologic defects, cardiomyopathy, high plasma phytosterol levels and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,048,146 E1331G probably damaging Het
Cdk12 T A 11: 98,204,292 S309T probably benign Het
Cep295nl T C 11: 118,333,599 R140G probably damaging Het
Chd8 A G 14: 52,232,698 V485A probably damaging Het
Chn2 A G 6: 54,300,218 I279V probably damaging Het
Cux2 A G 5: 121,865,978 S1032P probably damaging Het
Ddx55 T A 5: 124,554,565 M44K probably damaging Het
Dpyd T A 3: 118,781,943 H143Q probably benign Het
Fbxo10 A G 4: 45,058,934 W268R probably damaging Het
Gmfg A G 7: 28,446,394 D86G probably benign Het
Gpd1 T C 15: 99,722,140 V273A possibly damaging Het
Grhpr T C 4: 44,985,393 I158T probably damaging Het
Itpr2 A G 6: 146,476,693 F53L possibly damaging Het
Kctd21 A G 7: 97,347,970 I217V probably benign Het
Lrfn2 A G 17: 49,096,690 T614A probably benign Het
Lrrc7 T A 3: 158,175,326 D491V probably benign Het
Myo7b T C 18: 31,983,919 E916G probably damaging Het
Nf1 C T 11: 79,564,899 T550I probably damaging Het
Nsd1 A G 13: 55,312,334 T2125A probably benign Het
Olfml2b A G 1: 170,662,426 E205G probably benign Het
Olfr1084 A T 2: 86,638,806 L301I probably benign Het
Papolb T C 5: 142,529,217 T224A possibly damaging Het
Pcnx2 T C 8: 125,818,756 E1172G probably damaging Het
Ppip5k2 A G 1: 97,747,592 L362S possibly damaging Het
Ppp1r9b T A 11: 94,996,612 Y59* probably null Het
Pramef8 T C 4: 143,416,781 L39P probably damaging Het
Rapgef5 T A 12: 117,688,611 S76R probably benign Het
Rnh1 A T 7: 141,163,408 V218D probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Slc4a7 G T 14: 14,786,310 V999L probably benign Het
Slco4c1 A T 1: 96,842,529 I270N probably damaging Het
Tdp1 A G 12: 99,915,506 Y498C probably damaging Het
Tfip11 A G 5: 112,335,668 S650G probably benign Het
Ttn T C 2: 76,778,294 T17793A possibly damaging Het
Ulk2 T C 11: 61,783,613 T856A probably benign Het
Vps13d C T 4: 145,065,889 G3726E probably damaging Het
Other mutations in Abcg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Abcg5 APN 17 84664847 missense possibly damaging 0.73
IGL01844:Abcg5 APN 17 84682025 missense probably damaging 1.00
IGL02002:Abcg5 APN 17 84682051 nonsense probably null
IGL02116:Abcg5 APN 17 84673590 missense possibly damaging 0.67
IGL02339:Abcg5 APN 17 84673604 missense possibly damaging 0.95
IGL02568:Abcg5 APN 17 84670399 missense probably damaging 0.99
PIT4142001:Abcg5 UTSW 17 84673594 missense possibly damaging 0.59
R0539:Abcg5 UTSW 17 84669075 missense probably benign 0.01
R1104:Abcg5 UTSW 17 84682049 missense possibly damaging 0.78
R1795:Abcg5 UTSW 17 84673579 missense probably damaging 1.00
R1956:Abcg5 UTSW 17 84670375 missense probably damaging 1.00
R1970:Abcg5 UTSW 17 84673602 frame shift probably null
R2007:Abcg5 UTSW 17 84669920 missense probably damaging 1.00
R2118:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2120:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2121:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2122:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2124:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2858:Abcg5 UTSW 17 84670220 critical splice donor site probably null
R3121:Abcg5 UTSW 17 84658663 missense probably benign 0.33
R4694:Abcg5 UTSW 17 84672158 missense probably damaging 1.00
R4835:Abcg5 UTSW 17 84658648 missense possibly damaging 0.95
R4963:Abcg5 UTSW 17 84660141 nonsense probably null
R5187:Abcg5 UTSW 17 84658564 missense probably damaging 1.00
R5445:Abcg5 UTSW 17 84671129 missense probably damaging 1.00
R5580:Abcg5 UTSW 17 84660154 missense probably damaging 1.00
R5807:Abcg5 UTSW 17 84672291 missense probably damaging 0.99
R6007:Abcg5 UTSW 17 84668964 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGGTGTCATCCATGCCAAAATC -3'
(R):5'- GGTTGCTTATGGCCACTCTC -3'

Sequencing Primer
(F):5'- TGATCCCTAGAAGCCATGTCG -3'
(R):5'- ACTCTCTCAGTGGCCCAAGTG -3'
Posted On2016-08-04