Incidental Mutation 'R5349:Gm8994'
ID422766
Institutional Source Beutler Lab
Gene Symbol Gm8994
Ensembl Gene ENSMUSG00000094973
Gene Namepredicted gene 8994
Synonyms
MMRRC Submission 042928-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R5349 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location136327539-136329983 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 136329696 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 385 (D385V)
Ref Sequence ENSEMBL: ENSMUSP00000144809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077886] [ENSMUST00000204530] [ENSMUST00000204966]
Predicted Effect probably damaging
Transcript: ENSMUST00000077886
AA Change: D385V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133154
Gene: ENSMUSG00000094973
AA Change: D385V

DomainStartEndE-ValueType
DEXDc 57 254 4.55e-57 SMART
HELICc 291 372 1.63e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204530
AA Change: D385V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144809
Gene: ENSMUSG00000094973
AA Change: D385V

DomainStartEndE-ValueType
DEXDc 57 254 4.55e-57 SMART
HELICc 291 372 1.63e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204966
SMART Domains Protein: ENSMUSP00000145166
Gene: ENSMUSG00000094973

DomainStartEndE-ValueType
DEXDc 57 233 1.8e-41 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,867,958 E327G possibly damaging Het
Cd209d T G 8: 3,878,320 M22L probably benign Het
Chrna2 T C 14: 66,143,507 V75A probably damaging Het
Cnst A G 1: 179,622,897 E642G possibly damaging Het
Diaph1 A G 18: 37,891,072 V571A unknown Het
Dip2c C A 13: 9,622,653 H1032N probably damaging Het
Fbxl3 T C 14: 103,095,576 probably benign Het
Glb1 T C 9: 114,434,461 probably null Het
Gm8220 T C 14: 44,288,177 I101T probably benign Het
Grin2b A G 6: 136,044,283 C7R possibly damaging Het
Myo15 T C 11: 60,493,583 I516T probably damaging Het
Nr1i3 A G 1: 171,215,072 D89G possibly damaging Het
Ogfod1 T G 8: 94,055,248 probably benign Het
Olfr730 G T 14: 50,186,773 S148* probably null Het
Pard3 G T 8: 127,415,743 D930Y probably damaging Het
Pde7b C T 10: 20,619,186 C9Y probably damaging Het
Pilra T A 5: 137,831,226 D192V probably damaging Het
Ptprj A G 2: 90,471,261 S176P probably benign Het
Slc4a2 T C 5: 24,435,635 V685A possibly damaging Het
Srxn1 G A 2: 152,105,879 V66M probably damaging Het
Stox2 A G 8: 47,287,916 F44L possibly damaging Het
Tlr11 T C 14: 50,360,880 F108L probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ttn A C 2: 76,808,106 I13943M probably damaging Het
Wdfy4 T C 14: 32,988,899 D2577G probably damaging Het
Zyg11a A T 4: 108,183,732 F675I probably damaging Het
Other mutations in Gm8994
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Gm8994 APN 6 136329111 missense probably damaging 1.00
IGL02480:Gm8994 APN 6 136329215 missense probably damaging 1.00
IGL03048:Gm8994 UTSW 6 136329200 missense probably damaging 1.00
R0153:Gm8994 UTSW 6 136328844 missense probably damaging 0.99
R1602:Gm8994 UTSW 6 136328780 missense probably damaging 0.98
R2258:Gm8994 UTSW 6 136328561 missense probably benign 0.00
R3915:Gm8994 UTSW 6 136329422 missense probably benign 0.04
R4898:Gm8994 UTSW 6 136328739 missense possibly damaging 0.60
R4902:Gm8994 UTSW 6 136329264 missense probably benign 0.42
R5488:Gm8994 UTSW 6 136329557 missense probably damaging 1.00
R5491:Gm8994 UTSW 6 136329557 missense probably damaging 1.00
R5493:Gm8994 UTSW 6 136329557 missense probably damaging 1.00
R5494:Gm8994 UTSW 6 136329557 missense probably damaging 1.00
R5548:Gm8994 UTSW 6 136329570 missense probably damaging 0.99
R5668:Gm8994 UTSW 6 136329395 missense probably benign 0.00
R5998:Gm8994 UTSW 6 136328624 missense probably benign 0.23
R6393:Gm8994 UTSW 6 136328598 missense probably benign
R6898:Gm8994 UTSW 6 136328619 missense probably benign 0.10
R7180:Gm8994 UTSW 6 136329537 missense probably damaging 1.00
R7193:Gm8994 UTSW 6 136329215 missense probably damaging 1.00
R7274:Gm8994 UTSW 6 136329398 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ATGAAGGAGTTCCGGTCAGGTG -3'
(R):5'- CACGTGCATTAGAAAAGATGGC -3'

Sequencing Primer
(F):5'- TTCCGGTCAGGTGCCAGC -3'
(R):5'- CGGAGGCTGAGGGTCTTC -3'
Posted On2016-08-04