Incidental Mutation 'R0486:Yes1'
ID42279
Institutional Source Beutler Lab
Gene Symbol Yes1
Ensembl Gene ENSMUSG00000014932
Gene NameYES proto-oncogene 1, Src family tyrosine kinase
SynonymsYes
MMRRC Submission 038685-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.824) question?
Stock #R0486 (G1)
Quality Score183
Status Validated
Chromosome5
Chromosomal Location32611171-32687057 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 32655582 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 343 (Y343*)
Ref Sequence ENSEMBL: ENSMUSP00000144001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072311] [ENSMUST00000168707] [ENSMUST00000200999] [ENSMUST00000202543]
Predicted Effect probably null
Transcript: ENSMUST00000072311
AA Change: Y343*
SMART Domains Protein: ENSMUSP00000072154
Gene: ENSMUSG00000014932
AA Change: Y343*

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
SH3 92 149 5.03e-22 SMART
SH2 154 244 8.4e-35 SMART
TyrKc 275 524 8.39e-131 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155976
Predicted Effect probably null
Transcript: ENSMUST00000168707
AA Change: Y343*
SMART Domains Protein: ENSMUSP00000132161
Gene: ENSMUSG00000014932
AA Change: Y343*

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
SH3 92 149 5.03e-22 SMART
SH2 154 244 8.4e-35 SMART
TyrKc 275 524 8.39e-131 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200999
SMART Domains Protein: ENSMUSP00000144355
Gene: ENSMUSG00000014932

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
SH3 92 149 3.1e-24 SMART
SH2 154 198 2e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000202543
AA Change: Y343*
SMART Domains Protein: ENSMUSP00000144001
Gene: ENSMUSG00000014932
AA Change: Y343*

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
SH3 92 149 5.03e-22 SMART
SH2 154 244 8.4e-35 SMART
TyrKc 275 524 8.39e-131 SMART
Meta Mutation Damage Score 0.6176 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the cellular homolog of the Yamaguchi sarcoma virus oncogene. The encoded protein has tyrosine kinase activity and belongs to the src family of proteins. This gene lies in close proximity to thymidylate synthase gene on chromosome 18, and a corresponding pseudogene has been found on chromosome 22. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null alleles have no overt phenotype, but mice homozygous for both Yes and Src null mutations exhibit impaired movement and breathing, resulting in perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco1 T C 4: 40,177,783 L268P probably damaging Het
Adam22 A T 5: 8,330,048 H83Q probably damaging Het
Anln T C 9: 22,352,826 D886G probably benign Het
Arhgef11 T A 3: 87,688,852 probably null Het
Arl8b A T 6: 108,815,326 D116V possibly damaging Het
BC051665 C T 13: 60,784,045 G180D probably damaging Het
Bloc1s2 A G 19: 44,143,150 probably benign Het
Ccdc185 T G 1: 182,747,859 S422R possibly damaging Het
Cd101 T C 3: 101,008,092 K720E possibly damaging Het
Cdh23 C A 10: 60,386,946 A1236S probably damaging Het
Chd1 G A 17: 15,734,342 A491T probably damaging Het
Chdh T C 14: 30,032,858 V275A possibly damaging Het
Cmtm2b A T 8: 104,330,415 I136F probably damaging Het
Cps1 T C 1: 67,165,392 V457A probably damaging Het
Cwf19l1 A G 19: 44,114,690 V362A probably benign Het
Cyp4f17 T C 17: 32,524,823 probably benign Het
Cyp4f18 C A 8: 71,996,017 V263L probably benign Het
Dclre1a A G 19: 56,541,490 probably benign Het
Dpp6 T C 5: 27,661,642 I446T probably benign Het
F11r T C 1: 171,460,588 W61R probably damaging Het
Fam120b C T 17: 15,426,288 probably benign Het
Fastkd2 T C 1: 63,752,340 V669A possibly damaging Het
Foxg1 T C 12: 49,384,531 probably benign Het
Foxo3 A G 10: 42,197,481 Y347H probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gbp7 C A 3: 142,546,317 probably benign Het
Glipr1 T C 10: 111,996,849 probably benign Het
Gm11555 A G 11: 99,650,160 S8P unknown Het
H6pd G A 4: 149,982,936 probably benign Het
Haus8 C A 8: 71,256,537 G76W probably damaging Het
Haus8 C T 8: 71,256,538 M75I probably benign Het
Kcnj13 C A 1: 87,387,030 V157L probably damaging Het
Kcnt2 T A 1: 140,509,480 C550* probably null Het
Kdm5d A G Y: 927,107 N615S probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ncapd2 G A 6: 125,184,027 R292* probably null Het
Ngef T A 1: 87,479,126 N640I probably damaging Het
Nhlrc3 T C 3: 53,452,437 Y335C probably damaging Het
Nipbl A T 15: 8,338,870 probably benign Het
Nop2 A G 6: 125,140,673 K434R probably null Het
Nr4a3 T C 4: 48,056,525 probably benign Het
Olfr881 A G 9: 37,992,702 N70S possibly damaging Het
Piezo2 A C 18: 63,029,061 I2233R probably damaging Het
Prag1 A T 8: 36,146,633 E1113V probably damaging Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Psmd1 T A 1: 86,094,290 N611K probably damaging Het
Ptpn7 C T 1: 135,137,358 T168I probably damaging Het
Pus1 A T 5: 110,779,730 V53E probably damaging Het
Rgs22 A G 15: 36,092,882 M415T probably damaging Het
Rnf165 T A 18: 77,484,254 Q91L probably damaging Het
Rnf17 C T 14: 56,514,175 T1490M probably benign Het
Rnf20 C A 4: 49,645,907 L332I possibly damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spam1 A T 6: 24,796,395 Q115L probably damaging Het
Syce1l A T 8: 113,654,763 probably null Het
Synj1 T C 16: 90,938,263 probably benign Het
Tas2r126 A T 6: 42,435,291 I253F probably benign Het
Tecpr2 G A 12: 110,896,369 V72I probably benign Het
Tfap2a G T 13: 40,728,694 P45Q probably damaging Het
Trip12 C A 1: 84,761,084 G714* probably null Het
Wdr31 A G 4: 62,453,893 S330P probably damaging Het
Wdr64 T C 1: 175,795,203 probably benign Het
Other mutations in Yes1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Yes1 APN 5 32655129 missense probably benign 0.00
IGL02816:Yes1 APN 5 32645107 missense probably damaging 1.00
IGL02974:Yes1 APN 5 32660768 missense probably damaging 0.97
PIT4696001:Yes1 UTSW 5 32684625 missense possibly damaging 0.70
R0139:Yes1 UTSW 5 32684695 missense possibly damaging 0.87
R0481:Yes1 UTSW 5 32640405 nonsense probably null
R0526:Yes1 UTSW 5 32655240 missense probably benign 0.15
R0648:Yes1 UTSW 5 32655518 missense possibly damaging 0.90
R1083:Yes1 UTSW 5 32651757 critical splice donor site probably null
R1463:Yes1 UTSW 5 32651702 missense probably benign 0.04
R1569:Yes1 UTSW 5 32653163 missense probably damaging 1.00
R1899:Yes1 UTSW 5 32645051 missense probably damaging 1.00
R1918:Yes1 UTSW 5 32684735 missense probably benign 0.00
R2183:Yes1 UTSW 5 32645026 missense probably damaging 1.00
R2913:Yes1 UTSW 5 32640582 missense probably benign
R2914:Yes1 UTSW 5 32640582 missense probably benign
R3104:Yes1 UTSW 5 32653171 missense probably damaging 1.00
R4407:Yes1 UTSW 5 32640585 missense possibly damaging 0.51
R4736:Yes1 UTSW 5 32660777 missense probably damaging 0.98
R4939:Yes1 UTSW 5 32645113 splice site probably null
R6187:Yes1 UTSW 5 32645041 missense probably damaging 1.00
R6318:Yes1 UTSW 5 32651686 missense possibly damaging 0.92
R6467:Yes1 UTSW 5 32653037 missense probably damaging 0.98
X0062:Yes1 UTSW 5 32653043 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCGACTAGAGGTGAAACTAGGTCAA -3'
(R):5'- CTAAGTAAGAATAAAACTgggctggagagatg -3'

Sequencing Primer
(F):5'- TGGGTAAGAAGCCTGAACTTTG -3'
(R):5'- gttcaaatcccagcaaccac -3'
Posted On2013-05-23