Incidental Mutation 'R5361:C4b'
ID422834
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Namecomplement component 4B (Chido blood group)
SynonymsC4, Ss
MMRRC Submission 042940-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5361 (G1)
Quality Score177
Status Not validated
Chromosome17
Chromosomal Location34728380-34743882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34741238 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 280 (T280S)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
Predicted Effect probably benign
Transcript: ENSMUST00000069507
AA Change: T280S

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: T280S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174597
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T A 9: 57,257,185 K635N probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ahnak T A 19: 9,015,341 M4663K possibly damaging Het
Ccdc166 A G 15: 75,981,020 V366A probably benign Het
Cdh23 A G 10: 60,657,265 probably null Het
Col7a1 A G 9: 108,963,224 T1281A unknown Het
Cul9 TTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTC 17: 46,500,849 probably benign Het
Dbndd1 T A 8: 123,506,745 D127V probably damaging Het
Ddx20 T A 3: 105,683,509 E197V probably damaging Het
Dnm3 A G 1: 162,010,902 S826P probably damaging Het
Dnmt3a T C 12: 3,895,643 V24A probably benign Het
Dopey2 C A 16: 93,770,504 A1273E probably damaging Het
Dsg1c T C 18: 20,283,646 V868A possibly damaging Het
Dtx4 A G 19: 12,485,262 probably null Het
Elovl4 A G 9: 83,790,101 L55P possibly damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam45a A G 19: 60,825,886 M96V probably benign Het
Fbxo40 T A 16: 36,969,552 T399S possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm14399 T C 2: 175,131,578 E96G probably damaging Het
Gm14496 T G 2: 182,000,354 V606G probably benign Het
Gpr156 A G 16: 38,005,725 E768G probably damaging Het
Grm5 A T 7: 88,074,496 T665S probably damaging Het
Hsdl2 A G 4: 59,592,301 probably benign Het
Htt T C 5: 34,907,584 V3047A possibly damaging Het
Igkv3-2 A T 6: 70,699,027 T107S probably benign Het
Itih2 T A 2: 10,096,461 T899S probably benign Het
Lhcgr T A 17: 88,742,853 Y415F probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Med4 C A 14: 73,510,113 S18* probably null Het
Nefl T C 14: 68,084,639 V226A probably damaging Het
Nploc4 T A 11: 120,384,563 N516Y probably damaging Het
Olfr798 A T 10: 129,625,732 F110I probably damaging Het
Olfr99 A G 17: 37,279,610 V270A probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdha3 T G 18: 36,946,699 L165V possibly damaging Het
Pcdhb12 T A 18: 37,437,046 V415D probably damaging Het
Pcdhga10 T C 18: 37,747,450 I88T probably damaging Het
Pigyl T A 9: 22,157,996 M1K probably null Het
Prr27 T C 5: 87,843,344 S272P probably damaging Het
Prss3 C T 6: 41,373,846 D237N probably benign Het
Pstpip2 A G 18: 77,870,378 D150G probably damaging Het
Robo4 T A 9: 37,413,378 D909E probably benign Het
Serpinb3c A T 1: 107,276,931 Y28* probably null Het
Slc26a3 T C 12: 31,450,981 probably null Het
Slc6a1 A T 6: 114,302,532 I91F probably benign Het
Smcr8 T G 11: 60,778,292 Y89D probably damaging Het
Sspo T A 6: 48,466,313 M1898K probably benign Het
Tbl1xr1 T A 3: 22,192,069 I251K probably damaging Het
Thbs4 C T 13: 92,776,993 D140N probably benign Het
Tmbim6 G A 15: 99,405,752 A108T probably benign Het
Trim10 T G 17: 36,875,436 L301R probably benign Het
Trpm7 A T 2: 126,829,241 I607N possibly damaging Het
Vmn2r9 T A 5: 108,848,063 I240F probably damaging Het
Xpot T A 10: 121,600,860 I873F possibly damaging Het
Zfhx4 G A 3: 5,399,207 S1475N probably damaging Het
Zfp712 A G 13: 67,041,015 S483P possibly damaging Het
Zswim7 A T 11: 62,267,547 H122Q probably benign Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGATGGAAATGTGGGTCC -3'
(R):5'- CCATCTTTGCAAAGCCCAGC -3'

Sequencing Primer
(F):5'- AAATGTGGGTCCGGCCTTC -3'
(R):5'- AACTCACTGACTGGGCTAAGTTG -3'
Posted On2016-08-04