Incidental Mutation 'R5362:Spg11'
ID422855
Institutional Source Beutler Lab
Gene Symbol Spg11
Ensembl Gene ENSMUSG00000033396
Gene NameSPG11, spatacsin vesicle trafficking associated
SynonymsC530005A01Rik, 6030465E24Rik
MMRRC Submission 043264-MU
Accession Numbers

Genbank: NM_145531

Is this an essential gene? Possibly non essential (E-score: 0.471) question?
Stock #R5362 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location122053520-122118386 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 122061000 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1963 (N1963K)
Ref Sequence ENSEMBL: ENSMUSP00000037543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028668] [ENSMUST00000036450]
Predicted Effect probably benign
Transcript: ENSMUST00000028668
SMART Domains Protein: ENSMUSP00000028668
Gene: ENSMUSG00000027236

DomainStartEndE-ValueType
Pfam:eIF3_subunit 14 261 7.5e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000036450
AA Change: N1963K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037543
Gene: ENSMUSG00000033396
AA Change: N1963K

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 254 276 N/A INTRINSIC
low complexity region 945 958 N/A INTRINSIC
low complexity region 1250 1264 N/A INTRINSIC
low complexity region 1305 1313 N/A INTRINSIC
low complexity region 1673 1684 N/A INTRINSIC
low complexity region 1772 1784 N/A INTRINSIC
Pfam:Spatacsin_C 2082 2374 1.1e-105 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a potential transmembrane protein that is phosphorylated upon DNA damage. Defects in this gene are a cause of spastic paraplegia type 11 (SPG11). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a knock-out allele develop a progressive spastic and ataxic gait disorder and show loss of cortical motoneurons and Purkinje cells, a reduced number of lysosomes available for fusion with autophagosomes in degenerating neurons, and accumulation of autolysosome-derived material. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A T 6: 133,294,482 D163V probably benign Het
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankrd17 G A 5: 90,265,545 A1170V probably damaging Het
Ano1 A C 7: 144,648,600 probably benign Het
Atl2 T C 17: 79,861,461 N37D probably damaging Het
C2cd5 T C 6: 143,083,243 Y90C probably damaging Het
Carm1 A G 9: 21,587,359 N499S probably benign Het
Ccdc47 G A 11: 106,208,213 probably null Het
Cd300lf G T 11: 115,117,114 L251M probably damaging Het
Cfap74 A G 4: 155,438,166 S670G probably damaging Het
Clec4a1 A G 6: 122,932,237 D188G probably damaging Het
Col4a1 T C 8: 11,245,760 probably benign Het
Csn2 T A 5: 87,694,649 H165L probably benign Het
Dlx3 T C 11: 95,120,500 V60A possibly damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam221a A G 6: 49,376,115 H21R probably damaging Het
Foxj3 T A 4: 119,620,143 H349Q unknown Het
Gm37240 G A 3: 84,515,693 T123I probably damaging Het
Gpc1 A T 1: 92,854,893 T121S probably benign Het
Ikbkap A C 4: 56,778,969 I616S probably damaging Het
Itga2b A G 11: 102,461,135 V512A probably damaging Het
Itgae A G 11: 73,111,849 Y144C probably damaging Het
Izumo3 A T 4: 92,146,800 I60K possibly damaging Het
Kif9 G A 9: 110,489,944 V159M probably damaging Het
Lrp1b T C 2: 41,375,902 D229G probably damaging Het
Nkpd1 G A 7: 19,523,268 G324D probably damaging Het
Nrp2 T A 1: 62,769,062 Y617N probably benign Het
Ocm T C 5: 144,023,856 D91G probably damaging Het
Olfr600 A G 7: 103,346,247 V227A probably damaging Het
Olfr667 A G 7: 104,916,627 I223T probably damaging Het
Olfr724 A G 14: 49,960,529 L181P possibly damaging Het
Olfr814 T C 10: 129,874,553 E68G probably damaging Het
Pex5l G A 3: 32,992,916 A295V probably damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Pou2f2 G A 7: 25,092,895 P512S probably benign Het
Prpf8 G A 11: 75,506,410 R2023Q possibly damaging Het
Ptprd A T 4: 76,128,813 S399R probably damaging Het
Qrich2 T C 11: 116,447,150 Y1889C probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Ranbp6 G T 19: 29,811,728 T408K probably benign Het
Scn7a G A 2: 66,699,998 R668C probably damaging Het
Sertad4 T C 1: 192,847,106 N134S probably damaging Het
Svil C T 18: 5,057,345 P598S probably damaging Het
Top2a T C 11: 99,018,912 N120S probably damaging Het
Trappc9 C T 15: 73,058,217 E97K possibly damaging Het
Vmn1r91 A T 7: 20,101,461 T102S probably benign Het
Vmn2r99 G T 17: 19,379,339 M428I probably benign Het
Zfp62 A T 11: 49,216,612 H510L probably damaging Het
Other mutations in Spg11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Spg11 APN 2 122065560 missense probably damaging 0.96
IGL00495:Spg11 APN 2 122094456 critical splice donor site probably null
IGL00757:Spg11 APN 2 122070959 missense probably benign 0.05
IGL01304:Spg11 APN 2 122072290 missense probably damaging 1.00
IGL01355:Spg11 APN 2 122113156 missense probably benign
IGL01626:Spg11 APN 2 122060971 missense probably damaging 0.98
IGL01739:Spg11 APN 2 122114671 missense probably damaging 1.00
IGL01835:Spg11 APN 2 122088224 missense probably benign 0.36
IGL02129:Spg11 APN 2 122095686 missense probably damaging 0.99
IGL02178:Spg11 APN 2 122097302 missense probably damaging 1.00
IGL02199:Spg11 APN 2 122059553 missense probably damaging 1.00
IGL02212:Spg11 APN 2 122108157 missense probably benign 0.31
IGL02605:Spg11 APN 2 122092260 missense probably benign 0.00
IGL02635:Spg11 APN 2 122113068 missense possibly damaging 0.52
IGL02743:Spg11 APN 2 122059507 missense probably damaging 0.97
IGL02822:Spg11 APN 2 122074534 missense probably damaging 0.99
IGL02992:Spg11 APN 2 122058398 missense probably damaging 1.00
IGL03010:Spg11 APN 2 122088320 missense probably damaging 0.96
3-1:Spg11 UTSW 2 122086890 missense probably damaging 0.98
PIT4354001:Spg11 UTSW 2 122088185 missense probably damaging 0.98
R0131:Spg11 UTSW 2 122070968 missense probably damaging 1.00
R0206:Spg11 UTSW 2 122055696 critical splice donor site probably null
R0208:Spg11 UTSW 2 122055696 critical splice donor site probably null
R0302:Spg11 UTSW 2 122092187 missense possibly damaging 0.90
R0347:Spg11 UTSW 2 122097369 missense probably damaging 0.99
R0357:Spg11 UTSW 2 122066232 splice site probably benign
R0372:Spg11 UTSW 2 122059447 frame shift probably null
R0715:Spg11 UTSW 2 122084983 missense probably benign 0.03
R0927:Spg11 UTSW 2 122094487 missense probably damaging 0.99
R1163:Spg11 UTSW 2 122070941 missense probably damaging 1.00
R1534:Spg11 UTSW 2 122092325 missense probably damaging 1.00
R1555:Spg11 UTSW 2 122097377 missense probably damaging 0.99
R1569:Spg11 UTSW 2 122101706 missense probably damaging 0.99
R1840:Spg11 UTSW 2 122101756 missense probably damaging 1.00
R1929:Spg11 UTSW 2 122060207 missense probably damaging 1.00
R2265:Spg11 UTSW 2 122108307 missense possibly damaging 0.48
R2303:Spg11 UTSW 2 122068837 missense probably damaging 0.99
R2510:Spg11 UTSW 2 122075310 missense probably benign 0.03
R2760:Spg11 UTSW 2 122097359 missense probably damaging 0.99
R2918:Spg11 UTSW 2 122075301 missense probably damaging 0.99
R3195:Spg11 UTSW 2 122083398 critical splice donor site probably null
R3423:Spg11 UTSW 2 122071053 missense probably benign 0.00
R4353:Spg11 UTSW 2 122113194 missense possibly damaging 0.92
R4407:Spg11 UTSW 2 122075332 missense probably benign 0.00
R4644:Spg11 UTSW 2 122061029 missense probably benign 0.03
R4663:Spg11 UTSW 2 122098099 critical splice donor site probably null
R4684:Spg11 UTSW 2 122065076 missense probably damaging 1.00
R4771:Spg11 UTSW 2 122065482 nonsense probably null
R4810:Spg11 UTSW 2 122059796 missense probably damaging 1.00
R4829:Spg11 UTSW 2 122108455 missense probably benign 0.44
R5089:Spg11 UTSW 2 122114717 nonsense probably null
R5684:Spg11 UTSW 2 122093503 missense probably damaging 1.00
R5899:Spg11 UTSW 2 122098199 missense possibly damaging 0.67
R5923:Spg11 UTSW 2 122093478 missense probably damaging 0.98
R6052:Spg11 UTSW 2 122097356 missense probably damaging 0.99
R6111:Spg11 UTSW 2 122093482 missense probably damaging 0.98
R6174:Spg11 UTSW 2 122086805 intron probably null
R6226:Spg11 UTSW 2 122088262 missense possibly damaging 0.69
R6336:Spg11 UTSW 2 122112959 unclassified probably null
R6480:Spg11 UTSW 2 122092305 missense probably benign 0.03
R6494:Spg11 UTSW 2 122113225 missense probably damaging 0.98
R6582:Spg11 UTSW 2 122092292 missense probably damaging 0.99
R6714:Spg11 UTSW 2 122095731 missense probably damaging 0.99
R6791:Spg11 UTSW 2 122093443 missense probably damaging 0.99
R6836:Spg11 UTSW 2 122059535 missense probably damaging 1.00
R6928:Spg11 UTSW 2 122069904 missense probably benign 0.37
R7229:Spg11 UTSW 2 122108104 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCCATTATTTATAGAGAGGAGCCAG -3'
(R):5'- TCTGTCAGAAGTGGCTGCAG -3'

Sequencing Primer
(F):5'- CCCATGGAAGTTAAATATCTTGCTC -3'
(R):5'- AGGCCCAGATGCATCATG -3'
Posted On2016-08-04