Incidental Mutation 'R5362:Pex5l'
ID422857
Institutional Source Beutler Lab
Gene Symbol Pex5l
Ensembl Gene ENSMUSG00000027674
Gene Nameperoxisomal biogenesis factor 5-like
SynonymsPex2, PXR2, TRIP8b, 1700016J08Rik
MMRRC Submission 043264-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.432) question?
Stock #R5362 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location32949408-33143247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32992916 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 295 (A295V)
Ref Sequence ENSEMBL: ENSMUSP00000142196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078226] [ENSMUST00000108224] [ENSMUST00000108225] [ENSMUST00000108226] [ENSMUST00000192093] [ENSMUST00000193289] [ENSMUST00000193681] [ENSMUST00000194016]
Predicted Effect probably damaging
Transcript: ENSMUST00000078226
AA Change: A260V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077353
Gene: ENSMUSG00000027674
AA Change: A260V

DomainStartEndE-ValueType
low complexity region 113 129 N/A INTRINSIC
low complexity region 214 228 N/A INTRINSIC
TPR 349 382 6.95e-4 SMART
Blast:TPR 383 416 4e-14 BLAST
TPR 463 496 3.19e-3 SMART
TPR 497 530 3.47e-4 SMART
TPR 531 564 1.1e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108219
SMART Domains Protein: ENSMUSP00000103854
Gene: ENSMUSG00000027674

DomainStartEndE-ValueType
low complexity region 124 140 N/A INTRINSIC
low complexity region 226 240 N/A INTRINSIC
PDB:4EQF|A 266 362 8e-64 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000108224
AA Change: A236V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103859
Gene: ENSMUSG00000027674
AA Change: A236V

DomainStartEndE-ValueType
low complexity region 88 104 N/A INTRINSIC
low complexity region 190 204 N/A INTRINSIC
TPR 325 358 6.95e-4 SMART
Blast:TPR 359 392 2e-14 BLAST
TPR 439 472 3.19e-3 SMART
TPR 473 506 3.47e-4 SMART
TPR 507 540 1.1e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108225
AA Change: A260V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103860
Gene: ENSMUSG00000027674
AA Change: A260V

DomainStartEndE-ValueType
low complexity region 113 129 N/A INTRINSIC
low complexity region 214 228 N/A INTRINSIC
TPR 349 382 6.95e-4 SMART
Blast:TPR 383 416 4e-14 BLAST
TPR 463 496 3.19e-3 SMART
TPR 497 530 3.47e-4 SMART
TPR 531 564 1.1e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108226
AA Change: A212V

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103861
Gene: ENSMUSG00000027674
AA Change: A212V

DomainStartEndE-ValueType
low complexity region 65 81 N/A INTRINSIC
low complexity region 166 180 N/A INTRINSIC
TPR 301 334 6.95e-4 SMART
Blast:TPR 335 368 2e-14 BLAST
TPR 415 448 3.19e-3 SMART
TPR 449 482 3.47e-4 SMART
TPR 483 516 1.1e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192093
AA Change: A260V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141387
Gene: ENSMUSG00000027674
AA Change: A260V

DomainStartEndE-ValueType
low complexity region 113 129 N/A INTRINSIC
low complexity region 214 228 N/A INTRINSIC
TPR 349 382 6.95e-4 SMART
Blast:TPR 383 416 4e-14 BLAST
TPR 463 496 3.19e-3 SMART
TPR 497 530 3.47e-4 SMART
TPR 531 564 1.1e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193289
AA Change: A295V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142008
Gene: ENSMUSG00000027674
AA Change: A295V

DomainStartEndE-ValueType
low complexity region 148 164 N/A INTRINSIC
low complexity region 249 263 N/A INTRINSIC
TPR 384 417 6.95e-4 SMART
Blast:TPR 418 451 4e-14 BLAST
TPR 498 531 3.19e-3 SMART
TPR 532 565 3.47e-4 SMART
TPR 566 599 1.1e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193681
AA Change: A295V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141454
Gene: ENSMUSG00000027674
AA Change: A295V

DomainStartEndE-ValueType
low complexity region 148 164 N/A INTRINSIC
low complexity region 249 263 N/A INTRINSIC
TPR 384 417 6.95e-4 SMART
Blast:TPR 418 451 4e-14 BLAST
TPR 498 531 3.19e-3 SMART
TPR 532 565 3.47e-4 SMART
TPR 566 599 1.1e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194016
AA Change: A295V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142196
Gene: ENSMUSG00000027674
AA Change: A295V

DomainStartEndE-ValueType
low complexity region 148 164 N/A INTRINSIC
low complexity region 249 263 N/A INTRINSIC
TPR 384 417 6.95e-4 SMART
Blast:TPR 418 451 4e-14 BLAST
TPR 498 531 3.19e-3 SMART
TPR 532 565 3.47e-4 SMART
TPR 566 599 1.1e-1 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted mutation lacking isoform b exhibit exhibit reduced hyperpolarization-activated current in CA1 pyramidal neuron, impaired motor learning, impaired nest-building, decreased startle reflex, and decreased depression-related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A T 6: 133,294,482 D163V probably benign Het
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankrd17 G A 5: 90,265,545 A1170V probably damaging Het
Ano1 A C 7: 144,648,600 probably benign Het
Atl2 T C 17: 79,861,461 N37D probably damaging Het
C2cd5 T C 6: 143,083,243 Y90C probably damaging Het
Carm1 A G 9: 21,587,359 N499S probably benign Het
Ccdc47 G A 11: 106,208,213 probably null Het
Cd300lf G T 11: 115,117,114 L251M probably damaging Het
Cfap74 A G 4: 155,438,166 S670G probably damaging Het
Clec4a1 A G 6: 122,932,237 D188G probably damaging Het
Col4a1 T C 8: 11,245,760 probably benign Het
Csn2 T A 5: 87,694,649 H165L probably benign Het
Dlx3 T C 11: 95,120,500 V60A possibly damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam221a A G 6: 49,376,115 H21R probably damaging Het
Foxj3 T A 4: 119,620,143 H349Q unknown Het
Gm37240 G A 3: 84,515,693 T123I probably damaging Het
Gpc1 A T 1: 92,854,893 T121S probably benign Het
Ikbkap A C 4: 56,778,969 I616S probably damaging Het
Itga2b A G 11: 102,461,135 V512A probably damaging Het
Itgae A G 11: 73,111,849 Y144C probably damaging Het
Izumo3 A T 4: 92,146,800 I60K possibly damaging Het
Kif9 G A 9: 110,489,944 V159M probably damaging Het
Lrp1b T C 2: 41,375,902 D229G probably damaging Het
Nkpd1 G A 7: 19,523,268 G324D probably damaging Het
Nrp2 T A 1: 62,769,062 Y617N probably benign Het
Ocm T C 5: 144,023,856 D91G probably damaging Het
Olfr600 A G 7: 103,346,247 V227A probably damaging Het
Olfr667 A G 7: 104,916,627 I223T probably damaging Het
Olfr724 A G 14: 49,960,529 L181P possibly damaging Het
Olfr814 T C 10: 129,874,553 E68G probably damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Pou2f2 G A 7: 25,092,895 P512S probably benign Het
Prpf8 G A 11: 75,506,410 R2023Q possibly damaging Het
Ptprd A T 4: 76,128,813 S399R probably damaging Het
Qrich2 T C 11: 116,447,150 Y1889C probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Ranbp6 G T 19: 29,811,728 T408K probably benign Het
Scn7a G A 2: 66,699,998 R668C probably damaging Het
Sertad4 T C 1: 192,847,106 N134S probably damaging Het
Spg11 G T 2: 122,061,000 N1963K probably damaging Het
Svil C T 18: 5,057,345 P598S probably damaging Het
Top2a T C 11: 99,018,912 N120S probably damaging Het
Trappc9 C T 15: 73,058,217 E97K possibly damaging Het
Vmn1r91 A T 7: 20,101,461 T102S probably benign Het
Vmn2r99 G T 17: 19,379,339 M428I probably benign Het
Zfp62 A T 11: 49,216,612 H510L probably damaging Het
Other mutations in Pex5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Pex5l APN 3 32952597 missense probably damaging 1.00
IGL01621:Pex5l APN 3 33014961 splice site probably null
IGL01813:Pex5l APN 3 33082055 missense probably benign 0.02
IGL02313:Pex5l APN 3 32992992 missense probably benign 0.22
IGL02508:Pex5l APN 3 32992902 splice site probably benign
IGL02997:Pex5l APN 3 32955842 splice site probably benign
R0195:Pex5l UTSW 3 32992953 missense possibly damaging 0.87
R0674:Pex5l UTSW 3 32952616 missense probably damaging 1.00
R0729:Pex5l UTSW 3 32954536 splice site probably benign
R1500:Pex5l UTSW 3 33014980 missense probably damaging 1.00
R1513:Pex5l UTSW 3 33015013 nonsense probably null
R1695:Pex5l UTSW 3 32954382 missense probably benign 0.28
R1850:Pex5l UTSW 3 32950876 splice site probably null
R2165:Pex5l UTSW 3 32953132 synonymous probably null
R2679:Pex5l UTSW 3 33082052 missense probably benign 0.02
R2880:Pex5l UTSW 3 32993003 critical splice acceptor site probably null
R2881:Pex5l UTSW 3 32993003 critical splice acceptor site probably null
R3766:Pex5l UTSW 3 33007178 missense probably benign 0.01
R3780:Pex5l UTSW 3 32950844 missense probably damaging 1.00
R3934:Pex5l UTSW 3 33007172 missense probably damaging 1.00
R3975:Pex5l UTSW 3 33015015 missense probably damaging 0.99
R4285:Pex5l UTSW 3 33007187 missense probably damaging 1.00
R4825:Pex5l UTSW 3 32992985 missense probably damaging 0.99
R4855:Pex5l UTSW 3 33142840 splice site probably benign
R4868:Pex5l UTSW 3 32952490 missense probably damaging 1.00
R5135:Pex5l UTSW 3 32955831 missense probably damaging 1.00
R5217:Pex5l UTSW 3 33007328 splice site probably null
R5223:Pex5l UTSW 3 32958796 missense probably damaging 1.00
R5398:Pex5l UTSW 3 32952490 missense probably damaging 1.00
R5829:Pex5l UTSW 3 33005990 missense probably benign 0.00
R6731:Pex5l UTSW 3 32958798 missense probably damaging 1.00
R7180:Pex5l UTSW 3 33024691 splice site probably null
R7452:Pex5l UTSW 3 33004318 missense probably benign 0.02
R7549:Pex5l UTSW 3 33082035 missense probably benign 0.04
R7563:Pex5l UTSW 3 32954476 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTAATCACAGGACCAGTAGAAGAGC -3'
(R):5'- CCTTTGGAACGCTAGGGAAG -3'

Sequencing Primer
(F):5'- GTAGAAGAGCAGACACTTCCTGC -3'
(R):5'- CTTTGGAACGCTAGGGAAGTAACATG -3'
Posted On2016-08-04