Incidental Mutation 'R5362:Ccdc47'
List |< first << previous [record 35 of 217] next >> last >|
ID422891
Institutional Source Beutler Lab
Gene Symbol Ccdc47
Ensembl Gene ENSMUSG00000078622
Gene Namecoiled-coil domain containing 47
Synonymscalumin, asp4, 2610204L23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5362 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location106197408-106216344 bp(-) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) G to A at 106208213 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000002043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002043] [ENSMUST00000106865]
Predicted Effect probably null
Transcript: ENSMUST00000002043
SMART Domains Protein: ENSMUSP00000002043
Gene: ENSMUSG00000078622

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 23 38 N/A INTRINSIC
Pfam:DUF1682 134 467 2.1e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106865
SMART Domains Protein: ENSMUSP00000102478
Gene: ENSMUSG00000078622

DomainStartEndE-ValueType
Pfam:DUF1682 1 158 9.4e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125383
SMART Domains Protein: ENSMUSP00000122736
Gene: ENSMUSG00000078622

DomainStartEndE-ValueType
Pfam:DUF1682 1 212 1.3e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153982
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: More than half of homozygous null mice die at early embryonic stages while the rest die shortly after birth. Mouse embryonic fibroblasts display insufficient Ca2+ contents in intracellular stores, impaired store-operated Ca2+ entry, and enhanced endoplasmic reticulum stress-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A T 6: 133,294,482 D163V probably benign Het
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankrd17 G A 5: 90,265,545 A1170V probably damaging Het
Ano1 A C 7: 144,648,600 probably benign Het
Atl2 T C 17: 79,861,461 N37D probably damaging Het
C2cd5 T C 6: 143,083,243 Y90C probably damaging Het
Carm1 A G 9: 21,587,359 N499S probably benign Het
Cd300lf G T 11: 115,117,114 L251M probably damaging Het
Cfap74 A G 4: 155,438,166 S670G probably damaging Het
Clec4a1 A G 6: 122,932,237 D188G probably damaging Het
Col4a1 T C 8: 11,245,760 probably benign Het
Csn2 T A 5: 87,694,649 H165L probably benign Het
Dlx3 T C 11: 95,120,500 V60A possibly damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam221a A G 6: 49,376,115 H21R probably damaging Het
Foxj3 T A 4: 119,620,143 H349Q unknown Het
Gm37240 G A 3: 84,515,693 T123I probably damaging Het
Gpc1 A T 1: 92,854,893 T121S probably benign Het
Ikbkap A C 4: 56,778,969 I616S probably damaging Het
Itga2b A G 11: 102,461,135 V512A probably damaging Het
Itgae A G 11: 73,111,849 Y144C probably damaging Het
Izumo3 A T 4: 92,146,800 I60K possibly damaging Het
Kif9 G A 9: 110,489,944 V159M probably damaging Het
Lrp1b T C 2: 41,375,902 D229G probably damaging Het
Nkpd1 G A 7: 19,523,268 G324D probably damaging Het
Nrp2 T A 1: 62,769,062 Y617N probably benign Het
Ocm T C 5: 144,023,856 D91G probably damaging Het
Olfr600 A G 7: 103,346,247 V227A probably damaging Het
Olfr667 A G 7: 104,916,627 I223T probably damaging Het
Olfr724 A G 14: 49,960,529 L181P possibly damaging Het
Olfr814 T C 10: 129,874,553 E68G probably damaging Het
Pex5l G A 3: 32,992,916 A295V probably damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Pou2f2 G A 7: 25,092,895 P512S probably benign Het
Prpf8 G A 11: 75,506,410 R2023Q possibly damaging Het
Ptprd A T 4: 76,128,813 S399R probably damaging Het
Qrich2 T C 11: 116,447,150 Y1889C probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Ranbp6 G T 19: 29,811,728 T408K probably benign Het
Scn7a G A 2: 66,699,998 R668C probably damaging Het
Sertad4 T C 1: 192,847,106 N134S probably damaging Het
Spg11 G T 2: 122,061,000 N1963K probably damaging Het
Svil C T 18: 5,057,345 P598S probably damaging Het
Top2a T C 11: 99,018,912 N120S probably damaging Het
Trappc9 C T 15: 73,058,217 E97K possibly damaging Het
Vmn1r91 A T 7: 20,101,461 T102S probably benign Het
Vmn2r99 G T 17: 19,379,339 M428I probably benign Het
Zfp62 A T 11: 49,216,612 H510L probably damaging Het
Other mutations in Ccdc47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Ccdc47 APN 11 106203532 splice site probably null
IGL01890:Ccdc47 APN 11 106205451 missense probably damaging 1.00
IGL02026:Ccdc47 APN 11 106205027 missense probably damaging 0.96
IGL03343:Ccdc47 APN 11 106204962 missense probably damaging 0.99
R1508:Ccdc47 UTSW 11 106202416 missense probably damaging 1.00
R2239:Ccdc47 UTSW 11 106202134 missense possibly damaging 0.93
R3103:Ccdc47 UTSW 11 106202841 missense probably benign 0.00
R3935:Ccdc47 UTSW 11 106201997 unclassified probably benign
R4783:Ccdc47 UTSW 11 106203604 missense probably benign 0.03
R5150:Ccdc47 UTSW 11 106205439 missense possibly damaging 0.92
R5331:Ccdc47 UTSW 11 106210350 missense probably benign 0.17
R5417:Ccdc47 UTSW 11 106210350 missense probably benign 0.17
R5420:Ccdc47 UTSW 11 106210350 missense probably benign 0.17
R5473:Ccdc47 UTSW 11 106205029 missense probably damaging 0.98
R6297:Ccdc47 UTSW 11 106203601 missense probably damaging 0.99
R6449:Ccdc47 UTSW 11 106204985 missense probably damaging 1.00
R6981:Ccdc47 UTSW 11 106202737 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CACTTGATCACTCACTGGCC -3'
(R):5'- TGTCCAAGGAGATTCTGTGAG -3'

Sequencing Primer
(F):5'- TCATCCGGGCCAGGACATTAAG -3'
(R):5'- TGTCCAAGGAGATTCTGTGAGATAGC -3'
Posted On2016-08-04