Incidental Mutation 'R5364:Klra5'
ID423005
Institutional Source Beutler Lab
Gene Symbol Klra5
Ensembl Gene ENSMUSG00000030173
Gene Namekiller cell lectin-like receptor, subfamily A, member 5
SynonymsLy49e
MMRRC Submission 042942-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5364 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location129898996-129917650 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129899353 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 164 (F164L)
Ref Sequence ENSEMBL: ENSMUSP00000126290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014683] [ENSMUST00000118060] [ENSMUST00000169901]
Predicted Effect probably benign
Transcript: ENSMUST00000014683
AA Change: F254L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000014683
Gene: ENSMUSG00000030173
AA Change: F254L

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
Blast:CLECT 73 123 4e-9 BLAST
CLECT 143 258 3.66e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118060
AA Change: F254L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112795
Gene: ENSMUSG00000030173
AA Change: F254L

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
Blast:CLECT 73 123 4e-9 BLAST
CLECT 143 258 3.66e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167079
SMART Domains Protein: ENSMUSP00000125971
Gene: ENSMUSG00000030173

DomainStartEndE-ValueType
CLECT 53 168 3.66e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169901
AA Change: F164L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126290
Gene: ENSMUSG00000030173
AA Change: F164L

DomainStartEndE-ValueType
CLECT 53 168 3.66e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177871
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.3%
Validation Efficiency 100% (102/102)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal NK and T cell morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C G 7: 27,578,767 T242R probably damaging Het
Abcc10 G A 17: 46,305,651 R1205C probably benign Het
Acer1 A G 17: 56,982,000 F37L probably damaging Het
Acp7 C A 7: 28,611,023 G463V probably benign Het
Actr2 A T 11: 20,100,797 probably benign Het
Adam15 A T 3: 89,345,595 I272K probably damaging Het
Adam1b T A 5: 121,500,883 I700F possibly damaging Het
Adam33 A G 2: 131,054,472 probably null Het
Ano1 T C 7: 144,637,204 Y380C probably damaging Het
Arfgap3 A C 15: 83,314,361 M307R probably damaging Het
Arhgap21 T A 2: 20,849,722 R1610W probably damaging Het
Bbs2 A G 8: 94,074,395 Y603H probably benign Het
Bbs9 G T 9: 22,575,196 probably null Het
Bcar3 A C 3: 122,529,632 M779L probably benign Het
Bub3 A T 7: 131,560,738 N10I possibly damaging Het
Cacna1c T G 6: 118,656,543 E1098D probably benign Het
Cacna1g T A 11: 94,416,858 M1738L probably benign Het
Camk2d G T 3: 126,780,420 G159C probably damaging Het
Ccdc114 T A 7: 45,936,332 I105N probably damaging Het
Ccdc51 A T 9: 109,092,120 E358D possibly damaging Het
Cdc42bpa A G 1: 180,067,182 D309G probably benign Het
Cdhr3 A T 12: 33,051,008 F468I possibly damaging Het
Chrd A G 16: 20,733,148 M1V probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dcdc2b T C 4: 129,609,170 Y253C probably damaging Het
Dclk1 A C 3: 55,255,945 N153H possibly damaging Het
Dgkg G T 16: 22,600,461 S96R probably benign Het
Dnah9 A G 11: 65,881,696 Y3737H possibly damaging Het
Elovl4 A T 9: 83,790,023 I81N probably benign Het
Epha7 T A 4: 28,950,557 Y791N probably damaging Het
Fam105a G A 15: 27,659,945 Q24* probably null Het
Fam193a C A 5: 34,466,253 T1395N probably benign Het
Fbln5 A T 12: 101,771,364 V141E probably damaging Het
Flii T C 11: 60,720,128 T492A probably benign Het
Fnip2 A G 3: 79,481,168 I752T probably benign Het
Fpr3 T C 17: 17,970,544 W26R probably benign Het
Gabrb1 A T 5: 72,136,762 T460S probably benign Het
Gde1 T C 7: 118,698,651 N4S probably benign Het
Ghitm G T 14: 37,125,199 T306K probably benign Het
Ghitm A T 14: 37,125,217 I300N probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Iqcd T C 5: 120,600,267 I50T probably damaging Het
Itpripl1 G A 2: 127,141,819 P128S possibly damaging Het
Jag2 C A 12: 112,910,534 L1000F probably damaging Het
Klhdc4 A T 8: 121,806,636 probably benign Het
Larp1b A G 3: 40,977,223 Y288C probably damaging Het
Lrfn3 T A 7: 30,355,653 E622D possibly damaging Het
Lyst A G 13: 13,656,854 D1621G probably benign Het
Mastl T C 2: 23,133,653 T353A probably benign Het
Mkln1 T C 6: 31,496,712 Y130H probably damaging Het
Mms22l T A 4: 24,496,882 probably benign Het
Mroh7 T A 4: 106,691,643 M1008L probably benign Het
Nipal1 T C 5: 72,667,900 V312A probably damaging Het
Nlrp5 T A 7: 23,418,328 Y492* probably null Het
Olfr351 T C 2: 36,859,994 Y118C probably damaging Het
Pcdhb11 T A 18: 37,422,179 D187E probably benign Het
Pcdhb13 A G 18: 37,443,508 Y313C probably damaging Het
Pdpn G A 4: 143,273,956 T102I possibly damaging Het
Pear1 A T 3: 87,758,361 C120S probably damaging Het
Peg10 T C 6: 4,756,128 probably benign Het
Ppm1e A G 11: 87,237,181 W384R probably benign Het
Ppp1r10 C T 17: 35,930,432 P700S unknown Het
Prl2c5 G A 13: 13,183,042 R13K probably benign Het
Prmt3 C A 7: 49,848,806 P487T probably damaging Het
Proser3 C A 7: 30,546,148 A144S possibly damaging Het
Ptcd1 G A 5: 145,151,431 T590I probably damaging Het
Rbsn A G 6: 92,193,977 V321A probably damaging Het
Slc40a1 C A 1: 45,925,223 C14F probably damaging Het
Slc6a15 T C 10: 103,393,508 I136T probably damaging Het
Slc7a4 A G 16: 17,573,363 I449T probably benign Het
Snrnp48 T A 13: 38,210,189 probably null Het
Tada2a A G 11: 84,121,147 Y23H probably benign Het
Tbx15 A T 3: 99,352,192 S460C possibly damaging Het
Tbx21 C T 11: 97,101,478 probably null Het
Tmcc2 T G 1: 132,357,796 T376P probably damaging Het
Tmco4 G A 4: 139,052,504 C420Y probably damaging Het
Tmem235 C A 11: 117,864,194 Y157* probably null Het
Tmem63b T C 17: 45,664,727 probably benign Het
Tnfrsf1a T C 6: 125,357,393 S92P possibly damaging Het
Top3b A T 16: 16,886,970 T397S probably benign Het
Trabd C A 15: 89,082,804 probably benign Het
Trbv21 A T 6: 41,202,830 I27L possibly damaging Het
Trim3 C T 7: 105,619,069 V169M probably damaging Het
Ttn C T 2: 76,908,516 S3893N probably benign Het
Ttn T C 2: 76,977,114 T92A probably damaging Het
Uchl4 A T 9: 64,235,539 I101F possibly damaging Het
Vmn1r5 T A 6: 56,985,598 M86K probably damaging Het
Vmn2r55 T A 7: 12,670,903 Q191L possibly damaging Het
Zfp458 A T 13: 67,257,948 C139* probably null Het
Zfp788 T C 7: 41,650,127 L729P probably damaging Het
Zmym2 T A 14: 56,920,645 M547K possibly damaging Het
Other mutations in Klra5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Klra5 APN 6 129911359 missense possibly damaging 0.63
IGL00972:Klra5 APN 6 129906605 missense probably damaging 1.00
IGL01770:Klra5 APN 6 129906664 missense probably damaging 1.00
IGL01978:Klra5 APN 6 129911430 missense probably benign 0.32
IGL01998:Klra5 APN 6 129906713 nonsense probably null
IGL02103:Klra5 APN 6 129911344 splice site probably null
IGL02995:Klra5 APN 6 129906614 missense possibly damaging 0.46
IGL03036:Klra5 APN 6 129908867 missense probably damaging 0.99
R0314:Klra5 UTSW 6 129903590 missense probably damaging 1.00
R0378:Klra5 UTSW 6 129906614 missense possibly damaging 0.46
R0646:Klra5 UTSW 6 129903564 missense probably damaging 1.00
R0731:Klra5 UTSW 6 129908796 missense possibly damaging 0.88
R1552:Klra5 UTSW 6 129909885 missense probably damaging 0.97
R1572:Klra5 UTSW 6 129906622 missense probably damaging 1.00
R1807:Klra5 UTSW 6 129899420 missense probably benign 0.00
R4451:Klra5 UTSW 6 129908834 nonsense probably null
R4619:Klra5 UTSW 6 129908813 missense probably benign 0.05
R4647:Klra5 UTSW 6 129899376 missense probably damaging 0.99
R5019:Klra5 UTSW 6 129899389 missense probably benign
R6724:Klra5 UTSW 6 129906680 missense probably benign 0.29
R6925:Klra5 UTSW 6 129911457 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- AACAGTCCCAATGCTCCTGC -3'
(R):5'- TCCACTGATCAAACACTTGTGAG -3'

Sequencing Primer
(F):5'- CAGCTTTGTTTCTCTTCACAGCAGAC -3'
(R):5'- CGTGATGAACTTAGGATAAACAGTTC -3'
Posted On2016-08-04