Incidental Mutation 'R5330:Lct'
ID423110
Institutional Source Beutler Lab
Gene Symbol Lct
Ensembl Gene ENSMUSG00000026354
Gene Namelactase
SynonymsLPH, LOC226413, Lphl
MMRRC Submission 042912-MU
Accession Numbers

Genbank: NM_001081078; MGI:104576

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5330 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location128284756-128328318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 128298529 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1374 (D1374E)
Ref Sequence ENSEMBL: ENSMUSP00000073190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073490]
Predicted Effect probably benign
Transcript: ENSMUST00000073490
AA Change: D1374E

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000073190
Gene: ENSMUSG00000026354
AA Change: D1374E

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 76 226 1.6e-19 PFAM
low complexity region 322 340 N/A INTRINSIC
Pfam:Glyco_hydro_1 380 849 4.8e-169 PFAM
low complexity region 865 875 N/A INTRINSIC
Pfam:Glyco_hydro_1 902 1368 3.7e-181 PFAM
Pfam:Glyco_hydro_1 1377 1844 6.9e-183 PFAM
transmembrane domain 1885 1907 N/A INTRINSIC
Meta Mutation Damage Score 0.308 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyl hydrolase 1 family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme is integral to the plasma membrane and has both phlorizin hydrolase activity and lactase activity. Mutations in this gene are associated with congenital lactase deficiency. Polymorphisms in this gene are associated with lactase persistence, in which intestinal lactase activity persists at childhood levels into adulthood. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,091,858 probably benign Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
A2m A G 6: 121,638,416 D83G probably benign Het
Abca16 T A 7: 120,503,377 I833N probably benign Het
Adam6b C A 12: 113,490,580 P339H possibly damaging Het
Adgrb2 A T 4: 130,022,202 H1505L possibly damaging Het
Aktip A T 8: 91,126,724 F122I probably damaging Het
Ankrd27 T A 7: 35,615,926 L500* probably null Het
Blm T C 7: 80,458,936 E55G possibly damaging Het
Carmil1 A T 13: 24,025,946 probably null Het
Cdca7 T C 2: 72,484,698 C311R probably damaging Het
Cds1 T C 5: 101,798,495 S187P probably damaging Het
Chuk A T 19: 44,078,955 V587E probably damaging Het
Commd10 T C 18: 46,960,430 V19A probably damaging Het
Ctnnd2 C T 15: 30,332,115 T48I probably damaging Het
Cyp2b10 T A 7: 25,913,989 Y203* probably null Het
Dchs1 A T 7: 105,754,602 V2911E probably damaging Het
Dnah12 G A 14: 26,773,830 E1472K probably damaging Het
Dnah3 T C 7: 119,943,648 T3514A probably benign Het
Dnah6 T A 6: 73,074,590 I3074F probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fam131c A T 4: 141,382,830 T180S probably benign Het
Fbxo41 T C 6: 85,479,906 E427G probably benign Het
Gabrr2 A G 4: 33,082,583 K236E possibly damaging Het
Gm10152 A T 7: 144,763,546 noncoding transcript Het
Gm10313 T A 8: 46,255,453 noncoding transcript Het
Gm5414 C A 15: 101,624,664 V443F probably damaging Het
Gm7334 T C 17: 50,699,132 S149P possibly damaging Het
Grik2 G A 10: 49,132,771 T740M probably damaging Het
Hdac5 T C 11: 102,197,354 Y930C probably damaging Het
Hepacam2 T C 6: 3,483,377 T211A probably benign Het
Herc4 G T 10: 63,307,799 E703* probably null Het
Hivep2 A G 10: 14,131,420 K1254R probably damaging Het
Hras T C 7: 141,192,940 M1V probably null Het
Ikbkap T C 4: 56,800,001 T42A probably benign Het
Il23r T G 6: 67,423,495 Q617P probably damaging Het
Kank1 A G 19: 25,411,329 T789A probably damaging Het
Kcnj12 A G 11: 61,070,186 K437E probably benign Het
Luc7l C A 17: 26,275,733 C104* probably null Het
Lurap1 G A 4: 116,144,404 L31F probably damaging Het
Mark4 G A 7: 19,436,983 P321S probably damaging Het
Med18 A G 4: 132,463,066 probably benign Het
Mia2 A G 12: 59,095,812 S5G probably benign Het
Mrgprb3 T C 7: 48,642,934 T290A possibly damaging Het
Negr1 A T 3: 157,069,276 K210* probably null Het
Nktr T C 9: 121,752,768 probably benign Het
Nob1 T G 8: 107,416,249 T267P probably damaging Het
Nos3 A G 5: 24,369,904 E307G probably damaging Het
Nrxn2 A G 19: 6,490,081 T796A probably damaging Het
Nwd2 C A 5: 63,806,516 L1148I probably benign Het
Pcdh17 T A 14: 84,533,046 V988E probably damaging Het
Pcdha4 G A 18: 36,954,702 R646H probably benign Het
Per3 G T 4: 151,041,302 L187I probably damaging Het
Phlpp2 A G 8: 109,934,035 D774G probably damaging Het
Pibf1 T C 14: 99,140,646 Y403H probably damaging Het
Plcl2 G A 17: 50,509,848 A81T probably benign Het
Polr2a T C 11: 69,747,275 N123D probably benign Het
Psma5 T G 3: 108,268,070 V146G possibly damaging Het
Ptprk A T 10: 28,587,080 D189V probably damaging Het
Relb C T 7: 19,606,705 G509S possibly damaging Het
Rgs11 A T 17: 26,202,973 M1L probably benign Het
Rhbg T A 3: 88,245,468 T313S probably benign Het
Ripply2 T A 9: 87,015,638 probably benign Het
Scap T C 9: 110,381,633 V1011A probably benign Het
Scarf1 G A 11: 75,515,580 G230D probably damaging Het
Sel1l3 A T 5: 53,186,009 Y314N possibly damaging Het
Slc17a8 A G 10: 89,589,494 probably null Het
Slc22a14 A T 9: 119,230,596 L153Q probably damaging Het
Slc22a27 A G 19: 7,879,455 I406T probably benign Het
Slc30a6 A G 17: 74,423,195 D355G probably benign Het
Snta1 C A 2: 154,378,020 E403* probably null Het
Socs7 A G 11: 97,378,026 D382G possibly damaging Het
Spata31d1a A T 13: 59,700,403 C1304S possibly damaging Het
Srebf2 T A 15: 82,196,208 I834N possibly damaging Het
Steap1 G T 5: 5,740,422 H175Q probably damaging Het
Sult2a8 T C 7: 14,413,754 E204G possibly damaging Het
Tacc2 T C 7: 130,733,528 S524P probably damaging Het
Tbc1d9b C T 11: 50,146,313 A263V probably benign Het
Tecta A C 9: 42,337,856 D1903E probably damaging Het
Tmem222 A C 4: 133,277,624 M34R possibly damaging Het
Tnik A G 3: 28,542,018 T187A probably damaging Het
Trpv4 A G 5: 114,635,543 Y253H probably damaging Het
Trpv5 G A 6: 41,660,332 R358C probably benign Het
Ttll13 T C 7: 80,260,509 V800A probably benign Het
Ush2a G A 1: 188,728,381 G2613E probably benign Het
Vmn2r58 G A 7: 41,863,960 Q420* probably null Het
Zranb3 G A 1: 127,959,720 P990L probably damaging Het
Zswim9 T A 7: 13,259,985 D748V probably damaging Het
Other mutations in Lct
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Lct APN 1 128287556 missense probably benign 0.09
IGL00970:Lct APN 1 128304068 missense probably damaging 1.00
IGL01022:Lct APN 1 128300859 missense probably benign
IGL01878:Lct APN 1 128294266 missense probably damaging 1.00
IGL01892:Lct APN 1 128307605 missense probably damaging 1.00
IGL02307:Lct APN 1 128286590 missense possibly damaging 0.70
IGL02434:Lct APN 1 128303790 missense probably damaging 0.97
IGL02559:Lct APN 1 128294266 missense probably damaging 1.00
IGL02623:Lct APN 1 128308251 missense probably benign 0.01
IGL02818:Lct APN 1 128300168 missense probably damaging 1.00
IGL02949:Lct APN 1 128313132 missense probably benign 0.26
IGL02951:Lct APN 1 128300211 missense probably damaging 1.00
IGL03087:Lct APN 1 128300375 missense possibly damaging 0.81
IGL03227:Lct APN 1 128327689 missense probably benign 0.09
ANU18:Lct UTSW 1 128308047 nonsense probably null
R0071:Lct UTSW 1 128292018 nonsense probably null
R0071:Lct UTSW 1 128292018 nonsense probably null
R0135:Lct UTSW 1 128285123 missense probably damaging 0.98
R0145:Lct UTSW 1 128327895 missense probably benign 0.00
R0179:Lct UTSW 1 128327685 missense probably benign
R0331:Lct UTSW 1 128298742 splice site probably benign
R0366:Lct UTSW 1 128286462 missense probably benign 0.03
R0399:Lct UTSW 1 128300525 missense probably damaging 1.00
R0492:Lct UTSW 1 128300582 missense probably damaging 1.00
R0548:Lct UTSW 1 128285195 missense probably damaging 1.00
R0691:Lct UTSW 1 128308234 missense probably benign 0.00
R0755:Lct UTSW 1 128294135 missense possibly damaging 0.46
R0839:Lct UTSW 1 128286609 missense probably benign 0.00
R1128:Lct UTSW 1 128301309 missense probably damaging 0.99
R1135:Lct UTSW 1 128294124 critical splice donor site probably null
R1321:Lct UTSW 1 128300022 missense probably benign
R1448:Lct UTSW 1 128307822 missense probably damaging 0.99
R1450:Lct UTSW 1 128307903 missense probably damaging 1.00
R1572:Lct UTSW 1 128294195 missense probably benign 0.25
R1582:Lct UTSW 1 128300562 missense probably damaging 1.00
R1668:Lct UTSW 1 128287722 splice site probably null
R1757:Lct UTSW 1 128301257 missense probably damaging 1.00
R1775:Lct UTSW 1 128300301 missense probably damaging 1.00
R1792:Lct UTSW 1 128327942 missense possibly damaging 0.54
R1815:Lct UTSW 1 128300159 missense probably damaging 1.00
R1932:Lct UTSW 1 128294161 missense probably damaging 1.00
R2325:Lct UTSW 1 128304226 missense probably damaging 1.00
R2381:Lct UTSW 1 128304121 nonsense probably null
R3001:Lct UTSW 1 128304226 missense probably damaging 1.00
R3002:Lct UTSW 1 128304226 missense probably damaging 1.00
R3003:Lct UTSW 1 128304226 missense probably damaging 1.00
R3011:Lct UTSW 1 128301372 missense possibly damaging 0.74
R3082:Lct UTSW 1 128287608 missense probably damaging 1.00
R3683:Lct UTSW 1 128304226 missense probably damaging 1.00
R3684:Lct UTSW 1 128304226 missense probably damaging 1.00
R3726:Lct UTSW 1 128304226 missense probably damaging 1.00
R3886:Lct UTSW 1 128304226 missense probably damaging 1.00
R3887:Lct UTSW 1 128304226 missense probably damaging 1.00
R3888:Lct UTSW 1 128304226 missense probably damaging 1.00
R4019:Lct UTSW 1 128304226 missense probably damaging 1.00
R4027:Lct UTSW 1 128285181 missense probably benign 0.00
R4226:Lct UTSW 1 128304226 missense probably damaging 1.00
R4409:Lct UTSW 1 128304226 missense probably damaging 1.00
R4514:Lct UTSW 1 128300514 missense probably benign
R4570:Lct UTSW 1 128299904 missense probably benign 0.01
R4776:Lct UTSW 1 128300387 missense probably damaging 0.99
R5001:Lct UTSW 1 128308241 missense probably damaging 0.96
R5021:Lct UTSW 1 128300565 missense probably benign 0.38
R5318:Lct UTSW 1 128304372 missense probably damaging 1.00
R5385:Lct UTSW 1 128311617 missense possibly damaging 0.63
R5499:Lct UTSW 1 128286677 missense probably damaging 1.00
R5508:Lct UTSW 1 128294131 missense probably damaging 1.00
R5642:Lct UTSW 1 128295232 missense probably damaging 1.00
R5724:Lct UTSW 1 128300336 missense probably benign
R6026:Lct UTSW 1 128300018 missense probably benign
R6044:Lct UTSW 1 128307980 missense possibly damaging 0.95
R6175:Lct UTSW 1 128327714 missense probably damaging 1.00
R6277:Lct UTSW 1 128304237 missense probably benign 0.01
R6412:Lct UTSW 1 128327718 missense probably benign 0.00
R6480:Lct UTSW 1 128294320 missense probably damaging 1.00
R6526:Lct UTSW 1 128300478 missense probably benign 0.05
R6620:Lct UTSW 1 128295072 critical splice donor site probably null
R7214:Lct UTSW 1 128300460 missense probably benign 0.00
R7308:Lct UTSW 1 128319087 missense probably benign 0.00
X0052:Lct UTSW 1 128307630 missense probably damaging 1.00
YA93:Lct UTSW 1 128301320 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCAACCTGCTCCATTAGG -3'
(R):5'- TTGACCTTCGAGGCTACTCTG -3'

Sequencing Primer
(F):5'- ATTGCCCTGAATGCAGATGC -3'
(R):5'- TACTCTGCCTGGGCGCTG -3'
Posted On2016-08-04