Incidental Mutation 'R5330:Tnik'
ID423115
Institutional Source Beutler Lab
Gene Symbol Tnik
Ensembl Gene ENSMUSG00000027692
Gene NameTRAF2 and NCK interacting kinase
SynonymsC630040K21Rik, 1500031A17Rik, 4831440I19Rik, C530008O15Rik
MMRRC Submission 042912-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5330 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location28263214-28675858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28542018 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 187 (T187A)
Ref Sequence ENSEMBL: ENSMUSP00000124726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159236] [ENSMUST00000159308] [ENSMUST00000159680] [ENSMUST00000160307] [ENSMUST00000160518] [ENSMUST00000160934] [ENSMUST00000161964] [ENSMUST00000162485] [ENSMUST00000162777]
Predicted Effect possibly damaging
Transcript: ENSMUST00000159236
AA Change: T187A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124681
Gene: ENSMUSG00000027692
AA Change: T187A

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 793 812 N/A INTRINSIC
low complexity region 951 958 N/A INTRINSIC
CNH 1005 1303 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159308
AA Change: T187A
SMART Domains Protein: ENSMUSP00000125466
Gene: ENSMUSG00000027692
AA Change: T187A

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 746 765 N/A INTRINSIC
low complexity region 904 911 N/A INTRINSIC
CNH 958 1256 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159680
AA Change: T187A
SMART Domains Protein: ENSMUSP00000124876
Gene: ENSMUSG00000027692
AA Change: T187A

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
CNH 1034 1332 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000160307
AA Change: T187A
SMART Domains Protein: ENSMUSP00000125081
Gene: ENSMUSG00000027692
AA Change: T187A

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 830 849 N/A INTRINSIC
low complexity region 988 995 N/A INTRINSIC
CNH 1042 1340 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000160518
AA Change: T187A
SMART Domains Protein: ENSMUSP00000124011
Gene: ENSMUSG00000027692
AA Change: T187A

DomainStartEndE-ValueType
S_TKc 25 289 5.9e-99 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 801 820 N/A INTRINSIC
low complexity region 959 966 N/A INTRINSIC
CNH 1013 1311 9.3e-120 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160934
AA Change: T187A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123859
Gene: ENSMUSG00000027692
AA Change: T187A

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 25 212 2.2e-37 PFAM
Pfam:Pkinase 25 219 5.9e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161423
Predicted Effect probably damaging
Transcript: ENSMUST00000161964
AA Change: T187A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125411
Gene: ENSMUSG00000027692
AA Change: T187A

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 738 757 N/A INTRINSIC
low complexity region 896 903 N/A INTRINSIC
CNH 950 1248 1.92e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162037
Predicted Effect unknown
Transcript: ENSMUST00000162485
AA Change: T187A
SMART Domains Protein: ENSMUSP00000124387
Gene: ENSMUSG00000027692
AA Change: T187A

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 775 794 N/A INTRINSIC
low complexity region 933 940 N/A INTRINSIC
CNH 987 1285 1.92e-117 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162777
AA Change: T187A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124726
Gene: ENSMUSG00000027692
AA Change: T187A

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 767 786 N/A INTRINSIC
low complexity region 925 932 N/A INTRINSIC
CNH 979 1277 1.92e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193721
Meta Mutation Damage Score 0.22 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Germinal center kinases (GCKs), such as TNIK, are characterized by an N-terminal kinase domain and a C-terminal GCK domain that serves a regulatory function (Fu et al., 1999 [PubMed 10521462]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired postsynaptic signaling and cognitive function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,091,858 probably benign Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
A2m A G 6: 121,638,416 D83G probably benign Het
Abca16 T A 7: 120,503,377 I833N probably benign Het
Adam6b C A 12: 113,490,580 P339H possibly damaging Het
Adgrb2 A T 4: 130,022,202 H1505L possibly damaging Het
Aktip A T 8: 91,126,724 F122I probably damaging Het
Ankrd27 T A 7: 35,615,926 L500* probably null Het
Blm T C 7: 80,458,936 E55G possibly damaging Het
Carmil1 A T 13: 24,025,946 probably null Het
Cdca7 T C 2: 72,484,698 C311R probably damaging Het
Cds1 T C 5: 101,798,495 S187P probably damaging Het
Chuk A T 19: 44,078,955 V587E probably damaging Het
Commd10 T C 18: 46,960,430 V19A probably damaging Het
Ctnnd2 C T 15: 30,332,115 T48I probably damaging Het
Cyp2b10 T A 7: 25,913,989 Y203* probably null Het
Dchs1 A T 7: 105,754,602 V2911E probably damaging Het
Dnah12 G A 14: 26,773,830 E1472K probably damaging Het
Dnah3 T C 7: 119,943,648 T3514A probably benign Het
Dnah6 T A 6: 73,074,590 I3074F probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fam131c A T 4: 141,382,830 T180S probably benign Het
Fbxo41 T C 6: 85,479,906 E427G probably benign Het
Gabrr2 A G 4: 33,082,583 K236E possibly damaging Het
Gm10152 A T 7: 144,763,546 noncoding transcript Het
Gm10313 T A 8: 46,255,453 noncoding transcript Het
Gm5414 C A 15: 101,624,664 V443F probably damaging Het
Gm7334 T C 17: 50,699,132 S149P possibly damaging Het
Grik2 G A 10: 49,132,771 T740M probably damaging Het
Hdac5 T C 11: 102,197,354 Y930C probably damaging Het
Hepacam2 T C 6: 3,483,377 T211A probably benign Het
Herc4 G T 10: 63,307,799 E703* probably null Het
Hivep2 A G 10: 14,131,420 K1254R probably damaging Het
Hras T C 7: 141,192,940 M1V probably null Het
Ikbkap T C 4: 56,800,001 T42A probably benign Het
Il23r T G 6: 67,423,495 Q617P probably damaging Het
Kank1 A G 19: 25,411,329 T789A probably damaging Het
Kcnj12 A G 11: 61,070,186 K437E probably benign Het
Lct A T 1: 128,298,529 D1374E probably benign Het
Luc7l C A 17: 26,275,733 C104* probably null Het
Lurap1 G A 4: 116,144,404 L31F probably damaging Het
Mark4 G A 7: 19,436,983 P321S probably damaging Het
Med18 A G 4: 132,463,066 probably benign Het
Mia2 A G 12: 59,095,812 S5G probably benign Het
Mrgprb3 T C 7: 48,642,934 T290A possibly damaging Het
Negr1 A T 3: 157,069,276 K210* probably null Het
Nktr T C 9: 121,752,768 probably benign Het
Nob1 T G 8: 107,416,249 T267P probably damaging Het
Nos3 A G 5: 24,369,904 E307G probably damaging Het
Nrxn2 A G 19: 6,490,081 T796A probably damaging Het
Nwd2 C A 5: 63,806,516 L1148I probably benign Het
Pcdh17 T A 14: 84,533,046 V988E probably damaging Het
Pcdha4 G A 18: 36,954,702 R646H probably benign Het
Per3 G T 4: 151,041,302 L187I probably damaging Het
Phlpp2 A G 8: 109,934,035 D774G probably damaging Het
Pibf1 T C 14: 99,140,646 Y403H probably damaging Het
Plcl2 G A 17: 50,509,848 A81T probably benign Het
Polr2a T C 11: 69,747,275 N123D probably benign Het
Psma5 T G 3: 108,268,070 V146G possibly damaging Het
Ptprk A T 10: 28,587,080 D189V probably damaging Het
Relb C T 7: 19,606,705 G509S possibly damaging Het
Rgs11 A T 17: 26,202,973 M1L probably benign Het
Rhbg T A 3: 88,245,468 T313S probably benign Het
Ripply2 T A 9: 87,015,638 probably benign Het
Scap T C 9: 110,381,633 V1011A probably benign Het
Scarf1 G A 11: 75,515,580 G230D probably damaging Het
Sel1l3 A T 5: 53,186,009 Y314N possibly damaging Het
Slc17a8 A G 10: 89,589,494 probably null Het
Slc22a14 A T 9: 119,230,596 L153Q probably damaging Het
Slc22a27 A G 19: 7,879,455 I406T probably benign Het
Slc30a6 A G 17: 74,423,195 D355G probably benign Het
Snta1 C A 2: 154,378,020 E403* probably null Het
Socs7 A G 11: 97,378,026 D382G possibly damaging Het
Spata31d1a A T 13: 59,700,403 C1304S possibly damaging Het
Srebf2 T A 15: 82,196,208 I834N possibly damaging Het
Steap1 G T 5: 5,740,422 H175Q probably damaging Het
Sult2a8 T C 7: 14,413,754 E204G possibly damaging Het
Tacc2 T C 7: 130,733,528 S524P probably damaging Het
Tbc1d9b C T 11: 50,146,313 A263V probably benign Het
Tecta A C 9: 42,337,856 D1903E probably damaging Het
Tmem222 A C 4: 133,277,624 M34R possibly damaging Het
Trpv4 A G 5: 114,635,543 Y253H probably damaging Het
Trpv5 G A 6: 41,660,332 R358C probably benign Het
Ttll13 T C 7: 80,260,509 V800A probably benign Het
Ush2a G A 1: 188,728,381 G2613E probably benign Het
Vmn2r58 G A 7: 41,863,960 Q420* probably null Het
Zranb3 G A 1: 127,959,720 P990L probably damaging Het
Zswim9 T A 7: 13,259,985 D748V probably damaging Het
Other mutations in Tnik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Tnik APN 3 28654218 missense probably damaging 1.00
IGL00726:Tnik APN 3 28532898 missense probably damaging 1.00
IGL01022:Tnik APN 3 28625228 splice site probably null
IGL01145:Tnik APN 3 28604167 intron probably benign
IGL01664:Tnik APN 3 28638479 missense probably damaging 1.00
IGL01843:Tnik APN 3 28570858 splice site probably null
IGL02378:Tnik APN 3 28638459 nonsense probably null
IGL02448:Tnik APN 3 28621077 missense probably null 0.01
IGL02756:Tnik APN 3 28542030 missense probably damaging 1.00
IGL03332:Tnik APN 3 28666155 missense probably damaging 1.00
Usher UTSW 3 28564097 missense possibly damaging 0.61
R0135:Tnik UTSW 3 28607245 missense possibly damaging 0.67
R0418:Tnik UTSW 3 28570880 nonsense probably null
R0540:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0549:Tnik UTSW 3 28570920 missense possibly damaging 0.87
R0556:Tnik UTSW 3 28625218 missense possibly damaging 0.95
R0586:Tnik UTSW 3 28577361 splice site probably benign
R0607:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0842:Tnik UTSW 3 28594086 missense possibly damaging 0.72
R1068:Tnik UTSW 3 28532975 missense probably damaging 1.00
R1171:Tnik UTSW 3 28532940 missense probably damaging 1.00
R1597:Tnik UTSW 3 28604269 missense probably damaging 1.00
R1638:Tnik UTSW 3 28665740 missense probably damaging 0.99
R1652:Tnik UTSW 3 28604293 missense probably benign 0.22
R1996:Tnik UTSW 3 28665680 missense probably damaging 1.00
R2333:Tnik UTSW 3 28532996 missense probably damaging 1.00
R2426:Tnik UTSW 3 28646681 missense probably damaging 1.00
R2509:Tnik UTSW 3 28667915 missense probably damaging 1.00
R3774:Tnik UTSW 3 28638419 missense probably damaging 0.98
R3775:Tnik UTSW 3 28638419 missense probably damaging 0.98
R4007:Tnik UTSW 3 28604281 missense probably damaging 1.00
R4119:Tnik UTSW 3 28666175 missense probably damaging 1.00
R4209:Tnik UTSW 3 28359065 splice site probably benign
R4441:Tnik UTSW 3 28564097 missense possibly damaging 0.61
R4611:Tnik UTSW 3 28542100 critical splice donor site probably null
R4714:Tnik UTSW 3 28594077 missense possibly damaging 0.53
R4772:Tnik UTSW 3 28607210 missense probably benign 0.09
R4829:Tnik UTSW 3 28539541 intron probably benign
R4839:Tnik UTSW 3 28596075 missense possibly damaging 0.86
R4898:Tnik UTSW 3 28650086 missense probably damaging 1.00
R5029:Tnik UTSW 3 28665844 splice site probably null
R5278:Tnik UTSW 3 28650060 missense probably damaging 1.00
R5307:Tnik UTSW 3 28541972 missense probably damaging 1.00
R5375:Tnik UTSW 3 28594092 missense probably benign 0.02
R5459:Tnik UTSW 3 28661741 missense probably damaging 1.00
R5708:Tnik UTSW 3 28611971 critical splice donor site probably null
R5749:Tnik UTSW 3 28594092 missense probably benign 0.02
R5751:Tnik UTSW 3 28594092 missense probably benign 0.02
R5780:Tnik UTSW 3 28594092 missense probably benign 0.02
R5837:Tnik UTSW 3 28668053 unclassified probably benign
R5969:Tnik UTSW 3 28620948 missense probably damaging 1.00
R6244:Tnik UTSW 3 28650179 missense probably damaging 1.00
R6273:Tnik UTSW 3 28577500 missense possibly damaging 0.94
R6457:Tnik UTSW 3 28539448 missense probably damaging 1.00
R6464:Tnik UTSW 3 28611970 critical splice donor site probably null
R6473:Tnik UTSW 3 28263643 start codon destroyed probably null 0.93
R6737:Tnik UTSW 3 28596086 missense possibly damaging 0.72
R7049:Tnik UTSW 3 28661704 nonsense probably null
R7237:Tnik UTSW 3 28638419 missense probably damaging 0.98
R7267:Tnik UTSW 3 28646627 missense probably damaging 0.99
X0022:Tnik UTSW 3 28667951 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGGGCCCAGAAAATGTG -3'
(R):5'- TGTAAGCCACATGCAGGTGC -3'

Sequencing Primer
(F):5'- AATGGGCTAGGTCCCTCCATAATC -3'
(R):5'- CAGGTGCCTGTGAGGATCATC -3'
Posted On2016-08-04