Incidental Mutation 'R5330:A2m'
ID423138
Institutional Source Beutler Lab
Gene Symbol A2m
Ensembl Gene ENSMUSG00000030111
Gene Namealpha-2-macroglobulin
SynonymsA2mp
MMRRC Submission 042912-MU
Accession Numbers

NCBI RefSeq: NM_175628.3; MGI:2449119

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5330 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location121635376-121679227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121638416 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 83 (D83G)
Ref Sequence ENSEMBL: ENSMUSP00000032203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032203] [ENSMUST00000204850]
Predicted Effect probably benign
Transcript: ENSMUST00000032203
AA Change: D83G

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000032203
Gene: ENSMUSG00000030111
AA Change: D83G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:A2M_N 134 227 2.1e-20 PFAM
low complexity region 334 347 N/A INTRINSIC
A2M_N_2 465 613 2.04e-31 SMART
low complexity region 722 731 N/A INTRINSIC
A2M 738 828 2.31e-39 SMART
Pfam:Thiol-ester_cl 961 990 4.4e-18 PFAM
Pfam:A2M_comp 1010 1266 1.4e-98 PFAM
A2M_recep 1376 1463 2.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204850
Meta Mutation Damage Score 0.286 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease inhibitor and cytokine transporter. It uses a bait-and-trap mechanism to inhibit a broad spectrum of proteases, including trypsin, thrombin and collagenase. It can also inhibit inflammatory cytokines, and it thus disrupts inflammatory cascades. Mutations in this gene are a cause of alpha-2-macroglobulin deficiency. This gene is implicated in Alzheimer's disease (AD) due to its ability to mediate the clearance and degradation of A-beta, the major component of beta-amyloid deposits. A related pseudogene, which is also located on the p arm of chromosome 12, has been identified. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,091,858 probably benign Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abca16 T A 7: 120,503,377 I833N probably benign Het
Adam6b C A 12: 113,490,580 P339H possibly damaging Het
Adgrb2 A T 4: 130,022,202 H1505L possibly damaging Het
Aktip A T 8: 91,126,724 F122I probably damaging Het
Ankrd27 T A 7: 35,615,926 L500* probably null Het
Blm T C 7: 80,458,936 E55G possibly damaging Het
Carmil1 A T 13: 24,025,946 probably null Het
Cdca7 T C 2: 72,484,698 C311R probably damaging Het
Cds1 T C 5: 101,798,495 S187P probably damaging Het
Chuk A T 19: 44,078,955 V587E probably damaging Het
Commd10 T C 18: 46,960,430 V19A probably damaging Het
Ctnnd2 C T 15: 30,332,115 T48I probably damaging Het
Cyp2b10 T A 7: 25,913,989 Y203* probably null Het
Dchs1 A T 7: 105,754,602 V2911E probably damaging Het
Dnah12 G A 14: 26,773,830 E1472K probably damaging Het
Dnah3 T C 7: 119,943,648 T3514A probably benign Het
Dnah6 T A 6: 73,074,590 I3074F probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fam131c A T 4: 141,382,830 T180S probably benign Het
Fbxo41 T C 6: 85,479,906 E427G probably benign Het
Gabrr2 A G 4: 33,082,583 K236E possibly damaging Het
Gm10152 A T 7: 144,763,546 noncoding transcript Het
Gm10313 T A 8: 46,255,453 noncoding transcript Het
Gm5414 C A 15: 101,624,664 V443F probably damaging Het
Gm7334 T C 17: 50,699,132 S149P possibly damaging Het
Grik2 G A 10: 49,132,771 T740M probably damaging Het
Hdac5 T C 11: 102,197,354 Y930C probably damaging Het
Hepacam2 T C 6: 3,483,377 T211A probably benign Het
Herc4 G T 10: 63,307,799 E703* probably null Het
Hivep2 A G 10: 14,131,420 K1254R probably damaging Het
Hras T C 7: 141,192,940 M1V probably null Het
Ikbkap T C 4: 56,800,001 T42A probably benign Het
Il23r T G 6: 67,423,495 Q617P probably damaging Het
Kank1 A G 19: 25,411,329 T789A probably damaging Het
Kcnj12 A G 11: 61,070,186 K437E probably benign Het
Lct A T 1: 128,298,529 D1374E probably benign Het
Luc7l C A 17: 26,275,733 C104* probably null Het
Lurap1 G A 4: 116,144,404 L31F probably damaging Het
Mark4 G A 7: 19,436,983 P321S probably damaging Het
Med18 A G 4: 132,463,066 probably benign Het
Mia2 A G 12: 59,095,812 S5G probably benign Het
Mrgprb3 T C 7: 48,642,934 T290A possibly damaging Het
Negr1 A T 3: 157,069,276 K210* probably null Het
Nktr T C 9: 121,752,768 probably benign Het
Nob1 T G 8: 107,416,249 T267P probably damaging Het
Nos3 A G 5: 24,369,904 E307G probably damaging Het
Nrxn2 A G 19: 6,490,081 T796A probably damaging Het
Nwd2 C A 5: 63,806,516 L1148I probably benign Het
Pcdh17 T A 14: 84,533,046 V988E probably damaging Het
Pcdha4 G A 18: 36,954,702 R646H probably benign Het
Per3 G T 4: 151,041,302 L187I probably damaging Het
Phlpp2 A G 8: 109,934,035 D774G probably damaging Het
Pibf1 T C 14: 99,140,646 Y403H probably damaging Het
Plcl2 G A 17: 50,509,848 A81T probably benign Het
Polr2a T C 11: 69,747,275 N123D probably benign Het
Psma5 T G 3: 108,268,070 V146G possibly damaging Het
Ptprk A T 10: 28,587,080 D189V probably damaging Het
Relb C T 7: 19,606,705 G509S possibly damaging Het
Rgs11 A T 17: 26,202,973 M1L probably benign Het
Rhbg T A 3: 88,245,468 T313S probably benign Het
Ripply2 T A 9: 87,015,638 probably benign Het
Scap T C 9: 110,381,633 V1011A probably benign Het
Scarf1 G A 11: 75,515,580 G230D probably damaging Het
Sel1l3 A T 5: 53,186,009 Y314N possibly damaging Het
Slc17a8 A G 10: 89,589,494 probably null Het
Slc22a14 A T 9: 119,230,596 L153Q probably damaging Het
Slc22a27 A G 19: 7,879,455 I406T probably benign Het
Slc30a6 A G 17: 74,423,195 D355G probably benign Het
Snta1 C A 2: 154,378,020 E403* probably null Het
Socs7 A G 11: 97,378,026 D382G possibly damaging Het
Spata31d1a A T 13: 59,700,403 C1304S possibly damaging Het
Srebf2 T A 15: 82,196,208 I834N possibly damaging Het
Steap1 G T 5: 5,740,422 H175Q probably damaging Het
Sult2a8 T C 7: 14,413,754 E204G possibly damaging Het
Tacc2 T C 7: 130,733,528 S524P probably damaging Het
Tbc1d9b C T 11: 50,146,313 A263V probably benign Het
Tecta A C 9: 42,337,856 D1903E probably damaging Het
Tmem222 A C 4: 133,277,624 M34R possibly damaging Het
Tnik A G 3: 28,542,018 T187A probably damaging Het
Trpv4 A G 5: 114,635,543 Y253H probably damaging Het
Trpv5 G A 6: 41,660,332 R358C probably benign Het
Ttll13 T C 7: 80,260,509 V800A probably benign Het
Ush2a G A 1: 188,728,381 G2613E probably benign Het
Vmn2r58 G A 7: 41,863,960 Q420* probably null Het
Zranb3 G A 1: 127,959,720 P990L probably damaging Het
Zswim9 T A 7: 13,259,985 D748V probably damaging Het
Other mutations in A2m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:A2m APN 6 121644149 missense possibly damaging 0.67
IGL00798:A2m APN 6 121671010 missense probably damaging 1.00
IGL01154:A2m APN 6 121673542 nonsense probably null
IGL01313:A2m APN 6 121645010 critical splice donor site probably null
IGL01337:A2m APN 6 121668570 missense probably damaging 0.98
IGL01505:A2m APN 6 121676947 missense possibly damaging 0.83
IGL01508:A2m APN 6 121659367 nonsense probably null
IGL01672:A2m APN 6 121641357 missense probably damaging 1.00
IGL01951:A2m APN 6 121667190 missense possibly damaging 0.78
IGL02012:A2m APN 6 121674861 missense probably damaging 1.00
IGL02066:A2m APN 6 121649895 missense probably damaging 1.00
IGL02234:A2m APN 6 121668220 missense possibly damaging 0.67
IGL02397:A2m APN 6 121646875 missense probably benign
IGL02407:A2m APN 6 121668616 nonsense probably null
IGL02408:A2m APN 6 121644171 missense probably damaging 0.99
IGL02469:A2m APN 6 121668115 missense probably damaging 1.00
IGL02527:A2m APN 6 121661433 missense probably damaging 0.99
IGL02612:A2m APN 6 121678012 missense probably benign
IGL02746:A2m APN 6 121669503 splice site probably benign
IGL02952:A2m APN 6 121678025 missense probably damaging 0.99
IGL03056:A2m APN 6 121670903 missense probably damaging 0.96
IGL03121:A2m APN 6 121641306 missense probably benign 0.02
IGL03303:A2m APN 6 121667163 missense probably damaging 1.00
IGL03369:A2m APN 6 121676903 critical splice acceptor site probably null
IGL03046:A2m UTSW 6 121659323 missense probably benign 0.04
R0040:A2m UTSW 6 121645206 missense possibly damaging 0.93
R0049:A2m UTSW 6 121638308 missense possibly damaging 0.77
R0049:A2m UTSW 6 121638308 missense possibly damaging 0.77
R0109:A2m UTSW 6 121659303 missense probably benign 0.00
R0147:A2m UTSW 6 121662446 critical splice donor site probably null
R0148:A2m UTSW 6 121662446 critical splice donor site probably null
R0345:A2m UTSW 6 121638272 splice site probably benign
R0445:A2m UTSW 6 121657955 missense probably damaging 1.00
R0766:A2m UTSW 6 121676890 splice site probably benign
R1186:A2m UTSW 6 121661534 missense probably benign 0.00
R1436:A2m UTSW 6 121644213 missense probably benign 0.09
R1452:A2m UTSW 6 121678056 missense probably benign 0.01
R1636:A2m UTSW 6 121654612 missense probably benign 0.04
R1637:A2m UTSW 6 121654612 missense probably benign 0.04
R1638:A2m UTSW 6 121654612 missense probably benign 0.04
R1698:A2m UTSW 6 121645158 missense possibly damaging 0.88
R1776:A2m UTSW 6 121641424 missense probably damaging 1.00
R1791:A2m UTSW 6 121654612 missense probably benign 0.04
R1918:A2m UTSW 6 121644936 missense probably benign 0.16
R1921:A2m UTSW 6 121654612 missense probably benign 0.04
R1927:A2m UTSW 6 121636379 missense probably damaging 1.00
R1934:A2m UTSW 6 121649833 missense probably damaging 0.98
R1943:A2m UTSW 6 121668547 missense possibly damaging 0.90
R1996:A2m UTSW 6 121669597 missense probably damaging 1.00
R2039:A2m UTSW 6 121659949 missense probably benign 0.32
R2085:A2m UTSW 6 121676959 missense probably damaging 1.00
R2092:A2m UTSW 6 121674937 nonsense probably null
R2105:A2m UTSW 6 121673500 missense probably benign 0.04
R2107:A2m UTSW 6 121654612 missense probably benign 0.04
R2235:A2m UTSW 6 121642064 missense probably benign 0.21
R2292:A2m UTSW 6 121673559 missense possibly damaging 0.90
R2350:A2m UTSW 6 121678088 splice site probably benign
R3001:A2m UTSW 6 121661447 missense possibly damaging 0.88
R3002:A2m UTSW 6 121661447 missense possibly damaging 0.88
R3023:A2m UTSW 6 121669572 missense probably benign 0.08
R3429:A2m UTSW 6 121636290 start codon destroyed probably null
R3437:A2m UTSW 6 121639294 missense probably null 0.03
R3909:A2m UTSW 6 121648166 missense probably damaging 1.00
R4300:A2m UTSW 6 121673475 missense probably benign 0.00
R4332:A2m UTSW 6 121657447 missense probably benign 0.01
R4584:A2m UTSW 6 121657406 missense probably benign 0.07
R4697:A2m UTSW 6 121638284 start codon destroyed probably null 0.94
R4710:A2m UTSW 6 121641303 missense probably benign 0.03
R4841:A2m UTSW 6 121646844 missense probably benign 0.06
R5206:A2m UTSW 6 121674807 missense probably damaging 1.00
R5219:A2m UTSW 6 121676950 missense possibly damaging 0.90
R5230:A2m UTSW 6 121674861 missense probably damaging 1.00
R5331:A2m UTSW 6 121638416 missense probably benign 0.11
R5377:A2m UTSW 6 121645253 missense probably benign
R5590:A2m UTSW 6 121676932 missense probably damaging 1.00
R5835:A2m UTSW 6 121639336 missense probably damaging 1.00
R5910:A2m UTSW 6 121668117 missense probably damaging 1.00
R5915:A2m UTSW 6 121667163 missense probably damaging 1.00
R5949:A2m UTSW 6 121678073 missense probably damaging 1.00
R5994:A2m UTSW 6 121670903 missense probably benign 0.38
R5996:A2m UTSW 6 121659394 missense probably damaging 1.00
R6035:A2m UTSW 6 121638394 missense probably damaging 0.99
R6035:A2m UTSW 6 121638394 missense probably damaging 0.99
R6090:A2m UTSW 6 121648013 missense probably benign 0.45
R6241:A2m UTSW 6 121646829 missense probably benign 0.09
R6294:A2m UTSW 6 121654481 missense probably benign
R6492:A2m UTSW 6 121654505 missense probably benign 0.35
R6554:A2m UTSW 6 121641287 missense probably damaging 1.00
R6597:A2m UTSW 6 121648121 missense probably damaging 1.00
R6742:A2m UTSW 6 121678036 missense probably benign 0.01
R6795:A2m UTSW 6 121648322 intron probably null
R6843:A2m UTSW 6 121638401 missense probably benign 0.01
X0057:A2m UTSW 6 121668176 missense probably damaging 1.00
X0060:A2m UTSW 6 121676080 missense probably damaging 1.00
X0063:A2m UTSW 6 121646876 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCACATAGAGATGCTCATAGC -3'
(R):5'- GTGGTGACTCACGGTTAACC -3'

Sequencing Primer
(F):5'- GCTCATAGCAACAACCCCTTC -3'
(R):5'- GGTGACTCACGGTTAACCTTGAAC -3'
Posted On2016-08-04