Incidental Mutation 'R5330:Tbc1d9b'
ID423169
Institutional Source Beutler Lab
Gene Symbol Tbc1d9b
Ensembl Gene ENSMUSG00000036644
Gene NameTBC1 domain family, member 9B
Synonyms2700008N14Rik
MMRRC Submission 042912-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R5330 (G1)
Quality Score179
Status Validated
Chromosome11
Chromosomal Location50131396-50172785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 50146313 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 263 (A263V)
Ref Sequence ENSEMBL: ENSMUSP00000098828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093138] [ENSMUST00000101270]
Predicted Effect probably benign
Transcript: ENSMUST00000093138
AA Change: A263V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090825
Gene: ENSMUSG00000036644
AA Change: A263V

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
GRAM 142 209 1.21e-26 SMART
GRAM 288 356 3.02e-22 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 422 447 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
TBC 506 719 1.18e-57 SMART
Blast:TBC 727 810 2e-28 BLAST
low complexity region 1124 1138 N/A INTRINSIC
low complexity region 1144 1155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101270
AA Change: A263V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098828
Gene: ENSMUSG00000036644
AA Change: A263V

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
GRAM 142 209 1.21e-26 SMART
GRAM 288 356 3.02e-22 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 422 447 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
TBC 506 719 1.18e-57 SMART
Blast:TBC 727 810 3e-28 BLAST
low complexity region 970 980 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
low complexity region 1161 1172 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148887
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (95/96)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,091,858 probably benign Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
A2m A G 6: 121,638,416 D83G probably benign Het
Abca16 T A 7: 120,503,377 I833N probably benign Het
Adam6b C A 12: 113,490,580 P339H possibly damaging Het
Adgrb2 A T 4: 130,022,202 H1505L possibly damaging Het
Aktip A T 8: 91,126,724 F122I probably damaging Het
Ankrd27 T A 7: 35,615,926 L500* probably null Het
Blm T C 7: 80,458,936 E55G possibly damaging Het
Carmil1 A T 13: 24,025,946 probably null Het
Cdca7 T C 2: 72,484,698 C311R probably damaging Het
Cds1 T C 5: 101,798,495 S187P probably damaging Het
Chuk A T 19: 44,078,955 V587E probably damaging Het
Commd10 T C 18: 46,960,430 V19A probably damaging Het
Ctnnd2 C T 15: 30,332,115 T48I probably damaging Het
Cyp2b10 T A 7: 25,913,989 Y203* probably null Het
Dchs1 A T 7: 105,754,602 V2911E probably damaging Het
Dnah12 G A 14: 26,773,830 E1472K probably damaging Het
Dnah3 T C 7: 119,943,648 T3514A probably benign Het
Dnah6 T A 6: 73,074,590 I3074F probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fam131c A T 4: 141,382,830 T180S probably benign Het
Fbxo41 T C 6: 85,479,906 E427G probably benign Het
Gabrr2 A G 4: 33,082,583 K236E possibly damaging Het
Gm10152 A T 7: 144,763,546 noncoding transcript Het
Gm10313 T A 8: 46,255,453 noncoding transcript Het
Gm5414 C A 15: 101,624,664 V443F probably damaging Het
Gm7334 T C 17: 50,699,132 S149P possibly damaging Het
Grik2 G A 10: 49,132,771 T740M probably damaging Het
Hdac5 T C 11: 102,197,354 Y930C probably damaging Het
Hepacam2 T C 6: 3,483,377 T211A probably benign Het
Herc4 G T 10: 63,307,799 E703* probably null Het
Hivep2 A G 10: 14,131,420 K1254R probably damaging Het
Hras T C 7: 141,192,940 M1V probably null Het
Ikbkap T C 4: 56,800,001 T42A probably benign Het
Il23r T G 6: 67,423,495 Q617P probably damaging Het
Kank1 A G 19: 25,411,329 T789A probably damaging Het
Kcnj12 A G 11: 61,070,186 K437E probably benign Het
Lct A T 1: 128,298,529 D1374E probably benign Het
Luc7l C A 17: 26,275,733 C104* probably null Het
Lurap1 G A 4: 116,144,404 L31F probably damaging Het
Mark4 G A 7: 19,436,983 P321S probably damaging Het
Med18 A G 4: 132,463,066 probably benign Het
Mia2 A G 12: 59,095,812 S5G probably benign Het
Mrgprb3 T C 7: 48,642,934 T290A possibly damaging Het
Negr1 A T 3: 157,069,276 K210* probably null Het
Nktr T C 9: 121,752,768 probably benign Het
Nob1 T G 8: 107,416,249 T267P probably damaging Het
Nos3 A G 5: 24,369,904 E307G probably damaging Het
Nrxn2 A G 19: 6,490,081 T796A probably damaging Het
Nwd2 C A 5: 63,806,516 L1148I probably benign Het
Pcdh17 T A 14: 84,533,046 V988E probably damaging Het
Pcdha4 G A 18: 36,954,702 R646H probably benign Het
Per3 G T 4: 151,041,302 L187I probably damaging Het
Phlpp2 A G 8: 109,934,035 D774G probably damaging Het
Pibf1 T C 14: 99,140,646 Y403H probably damaging Het
Plcl2 G A 17: 50,509,848 A81T probably benign Het
Polr2a T C 11: 69,747,275 N123D probably benign Het
Psma5 T G 3: 108,268,070 V146G possibly damaging Het
Ptprk A T 10: 28,587,080 D189V probably damaging Het
Relb C T 7: 19,606,705 G509S possibly damaging Het
Rgs11 A T 17: 26,202,973 M1L probably benign Het
Rhbg T A 3: 88,245,468 T313S probably benign Het
Ripply2 T A 9: 87,015,638 probably benign Het
Scap T C 9: 110,381,633 V1011A probably benign Het
Scarf1 G A 11: 75,515,580 G230D probably damaging Het
Sel1l3 A T 5: 53,186,009 Y314N possibly damaging Het
Slc17a8 A G 10: 89,589,494 probably null Het
Slc22a14 A T 9: 119,230,596 L153Q probably damaging Het
Slc22a27 A G 19: 7,879,455 I406T probably benign Het
Slc30a6 A G 17: 74,423,195 D355G probably benign Het
Snta1 C A 2: 154,378,020 E403* probably null Het
Socs7 A G 11: 97,378,026 D382G possibly damaging Het
Spata31d1a A T 13: 59,700,403 C1304S possibly damaging Het
Srebf2 T A 15: 82,196,208 I834N possibly damaging Het
Steap1 G T 5: 5,740,422 H175Q probably damaging Het
Sult2a8 T C 7: 14,413,754 E204G possibly damaging Het
Tacc2 T C 7: 130,733,528 S524P probably damaging Het
Tecta A C 9: 42,337,856 D1903E probably damaging Het
Tmem222 A C 4: 133,277,624 M34R possibly damaging Het
Tnik A G 3: 28,542,018 T187A probably damaging Het
Trpv4 A G 5: 114,635,543 Y253H probably damaging Het
Trpv5 G A 6: 41,660,332 R358C probably benign Het
Ttll13 T C 7: 80,260,509 V800A probably benign Het
Ush2a G A 1: 188,728,381 G2613E probably benign Het
Vmn2r58 G A 7: 41,863,960 Q420* probably null Het
Zranb3 G A 1: 127,959,720 P990L probably damaging Het
Zswim9 T A 7: 13,259,985 D748V probably damaging Het
Other mutations in Tbc1d9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Tbc1d9b APN 11 50161633 missense probably damaging 1.00
IGL01870:Tbc1d9b APN 11 50162088 missense probably damaging 1.00
IGL02082:Tbc1d9b APN 11 50163882 missense probably benign 0.00
IGL02105:Tbc1d9b APN 11 50149826 missense probably damaging 0.96
IGL02264:Tbc1d9b APN 11 50149757 missense probably damaging 0.98
IGL02801:Tbc1d9b APN 11 50152830 missense probably damaging 1.00
IGL03111:Tbc1d9b APN 11 50158542 missense probably damaging 1.00
IGL02988:Tbc1d9b UTSW 11 50151946 missense possibly damaging 0.80
R0102:Tbc1d9b UTSW 11 50135849 missense probably damaging 1.00
R0109:Tbc1d9b UTSW 11 50158434 missense probably benign 0.02
R0131:Tbc1d9b UTSW 11 50135924 missense probably benign
R0463:Tbc1d9b UTSW 11 50145067 missense probably benign 0.00
R0472:Tbc1d9b UTSW 11 50168228 splice site probably null
R0846:Tbc1d9b UTSW 11 50171321 missense probably benign 0.01
R1099:Tbc1d9b UTSW 11 50146308 missense probably benign 0.04
R1276:Tbc1d9b UTSW 11 50152649 missense possibly damaging 0.87
R1642:Tbc1d9b UTSW 11 50149832 missense probably damaging 0.98
R2679:Tbc1d9b UTSW 11 50161701 splice site probably null
R2915:Tbc1d9b UTSW 11 50149736 missense possibly damaging 0.95
R3825:Tbc1d9b UTSW 11 50171127 missense possibly damaging 0.85
R3964:Tbc1d9b UTSW 11 50168696 missense possibly damaging 0.50
R4051:Tbc1d9b UTSW 11 50171243 missense probably benign 0.09
R4705:Tbc1d9b UTSW 11 50140462 missense probably benign 0.33
R4783:Tbc1d9b UTSW 11 50171298 missense probably benign 0.00
R5331:Tbc1d9b UTSW 11 50146313 missense probably benign
R5888:Tbc1d9b UTSW 11 50140484 missense probably benign 0.15
R5949:Tbc1d9b UTSW 11 50148049 missense probably benign
R6144:Tbc1d9b UTSW 11 50146328 missense probably benign
R6166:Tbc1d9b UTSW 11 50135846 missense probably damaging 1.00
R6331:Tbc1d9b UTSW 11 50131497 missense possibly damaging 0.95
R6432:Tbc1d9b UTSW 11 50146328 missense probably benign
R6856:Tbc1d9b UTSW 11 50168746 missense probably benign 0.11
R7110:Tbc1d9b UTSW 11 50163830 missense not run
R7134:Tbc1d9b UTSW 11 50152692 missense not run
X0065:Tbc1d9b UTSW 11 50168183 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCACACGCCTGGAGAAGAATG -3'
(R):5'- TGGCTCTACCTACACAATACTGTC -3'

Sequencing Primer
(F):5'- GGAGAAGAATGCCACTTTACTCTTCC -3'
(R):5'- CCTACACAATACTGTCATGGTTG -3'
Posted On2016-08-04