Incidental Mutation 'R0487:Mllt10'
ID42320
Institutional Source Beutler Lab
Gene Symbol Mllt10
Ensembl Gene ENSMUSG00000026743
Gene Namemyeloid/lymphoid or mixed-lineage leukemia; translocated to, 10
SynonymsAf10, D630001B22Rik, B130021D15Rik
MMRRC Submission 038686-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.580) question?
Stock #R0487 (G1)
Quality Score223
Status Not validated
Chromosome2
Chromosomal Location18055237-18212388 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18207137 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 411 (T411A)
Ref Sequence ENSEMBL: ENSMUSP00000110317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028076] [ENSMUST00000091418] [ENSMUST00000114669] [ENSMUST00000114671] [ENSMUST00000114680]
Predicted Effect probably benign
Transcript: ENSMUST00000028076
AA Change: T954A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028076
Gene: ENSMUSG00000026743
AA Change: T954A

DomainStartEndE-ValueType
PHD 24 72 8.51e-8 SMART
PHD 136 195 2.92e-6 SMART
low complexity region 217 248 N/A INTRINSIC
low complexity region 258 274 N/A INTRINSIC
low complexity region 308 326 N/A INTRINSIC
low complexity region 352 372 N/A INTRINSIC
low complexity region 490 515 N/A INTRINSIC
low complexity region 581 594 N/A INTRINSIC
low complexity region 609 627 N/A INTRINSIC
low complexity region 674 692 N/A INTRINSIC
coiled coil region 741 782 N/A INTRINSIC
low complexity region 836 879 N/A INTRINSIC
low complexity region 941 952 N/A INTRINSIC
low complexity region 966 986 N/A INTRINSIC
low complexity region 997 1018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091418
SMART Domains Protein: ENSMUSP00000088980
Gene: ENSMUSG00000026740

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
DnaJ 60 117 5.73e-23 SMART
transmembrane domain 149 171 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 269 281 N/A INTRINSIC
SANT 324 375 2.06e-6 SMART
low complexity region 416 434 N/A INTRINSIC
low complexity region 438 451 N/A INTRINSIC
SANT 491 543 3.56e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114669
AA Change: T411A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110317
Gene: ENSMUSG00000026743
AA Change: T411A

DomainStartEndE-ValueType
low complexity region 38 51 N/A INTRINSIC
low complexity region 66 84 N/A INTRINSIC
low complexity region 131 149 N/A INTRINSIC
coiled coil region 198 239 N/A INTRINSIC
low complexity region 293 336 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 454 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114671
AA Change: T876A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110319
Gene: ENSMUSG00000026743
AA Change: T876A

DomainStartEndE-ValueType
PHD 58 117 2.92e-6 SMART
low complexity region 139 170 N/A INTRINSIC
low complexity region 180 196 N/A INTRINSIC
low complexity region 230 248 N/A INTRINSIC
low complexity region 274 294 N/A INTRINSIC
low complexity region 412 437 N/A INTRINSIC
low complexity region 503 516 N/A INTRINSIC
low complexity region 531 549 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
coiled coil region 663 704 N/A INTRINSIC
low complexity region 758 801 N/A INTRINSIC
low complexity region 863 874 N/A INTRINSIC
low complexity region 888 908 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114680
AA Change: T954A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110328
Gene: ENSMUSG00000026743
AA Change: T954A

DomainStartEndE-ValueType
PHD 24 72 8.51e-8 SMART
PHD 136 195 2.92e-6 SMART
low complexity region 217 248 N/A INTRINSIC
low complexity region 258 274 N/A INTRINSIC
low complexity region 308 326 N/A INTRINSIC
low complexity region 352 372 N/A INTRINSIC
low complexity region 490 515 N/A INTRINSIC
low complexity region 581 594 N/A INTRINSIC
low complexity region 609 627 N/A INTRINSIC
low complexity region 674 692 N/A INTRINSIC
coiled coil region 741 782 N/A INTRINSIC
low complexity region 836 879 N/A INTRINSIC
low complexity region 941 952 N/A INTRINSIC
low complexity region 966 986 N/A INTRINSIC
low complexity region 997 1018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148401
SMART Domains Protein: ENSMUSP00000132289
Gene: ENSMUSG00000026740

DomainStartEndE-ValueType
SANT 2 49 1.74e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172210
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor and has been identified as a partner gene involved in several chromosomal rearrangements resulting in various leukemias. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,331,687 M3190L probably benign Het
Adgrv1 A T 13: 81,489,035 L3429H probably damaging Het
Ahnak A G 19: 9,007,151 N1933S probably benign Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
AI314180 A G 4: 58,819,155 V1265A probably damaging Het
Amacr A G 15: 10,984,749 D151G probably benign Het
Ano9 A T 7: 141,107,849 H255Q possibly damaging Het
Asphd2 A T 5: 112,391,635 Y111N probably damaging Het
Cage1 T A 13: 38,025,358 K214N probably benign Het
Cdkn2c A G 4: 109,661,409 L116P probably damaging Het
Cltc C T 11: 86,733,664 R148H probably damaging Het
Cmbl A G 15: 31,582,030 N58D probably damaging Het
Cpa6 T C 1: 10,409,262 T249A possibly damaging Het
Cpsf1 T A 15: 76,597,002 N1218I probably damaging Het
Csf2rb T C 15: 78,348,331 S613P probably benign Het
Ctnnd1 A G 2: 84,609,067 S761P probably damaging Het
Cxcr6 A C 9: 123,810,398 I155L probably benign Het
Fam216a A G 5: 122,370,513 probably null Het
Fgf10 T A 13: 118,781,611 probably null Het
Fgf17 T C 14: 70,638,556 T79A probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm1527 G T 3: 28,926,679 V643L probably benign Het
Gm7534 A T 4: 134,202,778 L72Q probably damaging Het
Hmcn2 A T 2: 31,386,677 Q1556L possibly damaging Het
Hrasls G A 16: 29,220,579 probably null Het
Hspa4l C T 3: 40,784,326 T616I possibly damaging Het
Irgm1 T C 11: 48,866,327 D219G probably damaging Het
Jcad A G 18: 4,673,243 D335G probably damaging Het
Kcnh4 A G 11: 100,750,258 F455S probably damaging Het
Khdrbs3 T C 15: 69,017,361 Y120H probably damaging Het
Kndc1 A T 7: 139,914,023 T507S probably null Het
Lepr G T 4: 101,768,093 E482* probably null Het
Lrmp A G 6: 145,165,260 S264G probably benign Het
Mcemp1 T A 8: 3,667,507 M146K probably benign Het
Myh8 A T 11: 67,302,011 I1543L probably benign Het
Myo1f T C 17: 33,578,284 S147P probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Olfr1106 C T 2: 87,048,493 V248I probably damaging Het
Plch2 G A 4: 155,009,012 R57C probably damaging Het
Rbm20 G A 19: 53,851,195 G872R probably damaging Het
Retsat A T 6: 72,606,431 I373F probably damaging Het
Rnf145 T C 11: 44,555,229 F297L probably benign Het
Ros1 A T 10: 52,155,108 M479K possibly damaging Het
Rubcnl T A 14: 75,036,081 N244K probably benign Het
Samhd1 A G 2: 157,110,615 F406L probably damaging Het
Sdsl A T 5: 120,459,468 V258D probably damaging Het
Sec24c C G 14: 20,683,399 P166A probably benign Het
Sele C A 1: 164,053,615 Y461* probably null Het
Slc22a1 G T 17: 12,662,600 S334* probably null Het
Spem1 T G 11: 69,821,865 probably null Het
Stat3 T C 11: 100,903,643 E280G probably damaging Het
Stxbp4 T C 11: 90,592,360 H280R probably benign Het
Tas2r129 G A 6: 132,951,943 C281Y probably benign Het
Tas2r129 T G 6: 132,951,944 C281W probably benign Het
Tcp11 T A 17: 28,079,923 probably null Het
Tnrc6b G A 15: 80,880,675 V793M probably benign Het
Vmn2r59 A C 7: 42,047,104 Y71* probably null Het
Wdr35 T C 12: 9,012,743 probably null Het
Zan A G 5: 137,413,358 probably null Het
Zap70 G T 1: 36,779,284 V351L probably damaging Het
Zfp609 G T 9: 65,702,634 Q1016K unknown Het
Zfp641 C A 15: 98,289,179 V188L probably benign Het
Other mutations in Mllt10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01646:Mllt10 APN 2 18122317 missense probably damaging 1.00
IGL02366:Mllt10 APN 2 18065087 missense probably damaging 0.99
IGL02990:Mllt10 APN 2 18123711 splice site probably benign
IGL03034:Mllt10 APN 2 18065036 start codon destroyed probably null 0.55
R0348:Mllt10 UTSW 2 18162613 missense probably damaging 1.00
R0492:Mllt10 UTSW 2 18146887 splice site probably benign
R0518:Mllt10 UTSW 2 18071206 critical splice donor site probably null
R0720:Mllt10 UTSW 2 18196595 missense probably benign
R0733:Mllt10 UTSW 2 18203766 intron probably benign
R1532:Mllt10 UTSW 2 18092835 critical splice donor site probably null
R1665:Mllt10 UTSW 2 18208790 missense possibly damaging 0.93
R1768:Mllt10 UTSW 2 18162846 missense probably damaging 1.00
R2098:Mllt10 UTSW 2 18162653 missense possibly damaging 0.50
R2114:Mllt10 UTSW 2 18162569 missense probably benign
R2116:Mllt10 UTSW 2 18162569 missense probably benign
R2117:Mllt10 UTSW 2 18162569 missense probably benign
R2179:Mllt10 UTSW 2 18210793 missense probably damaging 1.00
R2192:Mllt10 UTSW 2 18207060 missense probably benign 0.11
R2510:Mllt10 UTSW 2 18065124 missense possibly damaging 0.94
R2511:Mllt10 UTSW 2 18065124 missense possibly damaging 0.94
R4669:Mllt10 UTSW 2 18203633 missense probably damaging 1.00
R5004:Mllt10 UTSW 2 18170268 missense probably damaging 1.00
R5072:Mllt10 UTSW 2 18109874 missense possibly damaging 0.72
R5187:Mllt10 UTSW 2 18208774 nonsense probably null
R5561:Mllt10 UTSW 2 18109845 missense probably damaging 0.98
R6141:Mllt10 UTSW 2 18210793 missense probably damaging 1.00
R6352:Mllt10 UTSW 2 18123793 missense probably damaging 1.00
R6844:Mllt10 UTSW 2 18159483 missense probably benign 0.02
R7060:Mllt10 UTSW 2 18159560 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TTGACCTCCAGTGGACAAAGCACC -3'
(R):5'- TGTGCTGTTCAAATGTGAGGAGCC -3'

Sequencing Primer
(F):5'- AAGCACCAGCAGTTCTTCTG -3'
(R):5'- GTTTGATATCCCAGATCAGGACCG -3'
Posted On2013-05-23