Incidental Mutation 'R5331:Cds1'
ID423225
Institutional Source Beutler Lab
Gene Symbol Cds1
Ensembl Gene ENSMUSG00000029330
Gene NameCDP-diacylglycerol synthase 1
Synonyms4833409J18Rik, phosphatidate cytidylyltransferase
MMRRC Submission 042913-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R5331 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location101765130-101823858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101798495 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 187 (S187P)
Ref Sequence ENSEMBL: ENSMUSP00000031273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031273]
Predicted Effect probably damaging
Transcript: ENSMUST00000031273
AA Change: S187P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031273
Gene: ENSMUSG00000029330
AA Change: S187P

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
Pfam:CTP_transf_1 87 417 6.4e-89 PFAM
low complexity region 427 439 N/A INTRINSIC
Meta Mutation Damage Score 0.268 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Breakdown products of phosphoinositides are ubiquitous second messengers that function downstream of many G protein-coupled receptors and tyrosine kinases regulating cell growth, calcium metabolism, and protein kinase C activity. This gene encodes an enzyme which regulates the amount of phosphatidylinositol available for signaling by catalyzing the conversion of phosphatidic acid to CDP-diacylglycerol. This enzyme is an integral membrane protein localized to two subcellular domains, the matrix side of the inner mitochondrial membrane where it is thought to be involved in the synthesis of phosphatidylglycerol and cardiolipin and the cytoplasmic side of the endoplasmic reticulum where it functions in phosphatidylinositol biosynthesis. Two genes encoding this enzyme have been identified in humans, one mapping to human chromosome 4q21 and a second to 20p13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,091,858 probably benign Het
A2m A G 6: 121,638,416 D83G probably benign Het
Ablim1 T C 19: 57,155,249 T80A probably damaging Het
Adam6b C A 12: 113,490,580 P339H possibly damaging Het
Adgrb2 A T 4: 130,022,202 H1505L possibly damaging Het
Ankrd46 G A 15: 36,486,029 T26I probably benign Het
Bmpr1b T C 3: 141,856,415 N337S probably damaging Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cct5 A G 15: 31,594,302 probably benign Het
Cdca2 T C 14: 67,677,471 K780E possibly damaging Het
Ces3a G A 8: 105,057,556 E416K probably damaging Het
Chd8 T A 14: 52,202,114 probably benign Het
Chuk A T 19: 44,078,955 V587E probably damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Commd10 T C 18: 46,960,430 V19A probably damaging Het
Ctsa A G 2: 164,834,309 probably benign Het
Dnah6 T A 6: 73,074,590 I3074F probably damaging Het
Dydc1 T C 14: 41,082,363 probably null Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Enpp3 T A 10: 24,808,160 N227I probably damaging Het
Fam131c A T 4: 141,382,830 T180S probably benign Het
Fam193a C A 5: 34,465,571 probably null Het
Fbxo41 T C 6: 85,479,906 E427G probably benign Het
Gabrr2 A G 4: 33,082,583 K236E possibly damaging Het
Gm10152 A T 7: 144,763,546 noncoding transcript Het
Gm18025 C T 12: 34,290,575 C173Y probably benign Het
Gm1966 T C 7: 106,598,751 noncoding transcript Het
Gm5414 C A 15: 101,624,664 V443F probably damaging Het
Gm7334 T C 17: 50,699,132 S149P possibly damaging Het
Gpaa1 T A 15: 76,332,311 probably benign Het
Grik2 G A 10: 49,132,771 T740M probably damaging Het
Hdac5 T C 11: 102,197,354 Y930C probably damaging Het
Hepacam2 T C 6: 3,483,377 T211A probably benign Het
Herc4 G T 10: 63,307,799 E703* probably null Het
Hras T C 7: 141,192,940 M1V probably null Het
Ikbkap T C 4: 56,800,001 T42A probably benign Het
Il23r T G 6: 67,423,495 Q617P probably damaging Het
Insc T A 7: 114,845,038 M420K probably damaging Het
Ints10 A T 8: 68,820,820 probably null Het
Kank1 A G 19: 25,411,329 T789A probably damaging Het
Kat6a T A 8: 22,939,984 L1785Q unknown Het
Kcnj12 A G 11: 61,070,186 K437E probably benign Het
Knl1 T A 2: 119,070,255 D812E possibly damaging Het
Luc7l C A 17: 26,275,733 C104* probably null Het
Lurap1 G A 4: 116,144,404 L31F probably damaging Het
Mia2 A G 12: 59,095,812 S5G probably benign Het
Mon1b C T 8: 113,636,267 T49I probably null Het
Mrgprb3 T C 7: 48,642,934 T290A possibly damaging Het
Mxd3 T C 13: 55,329,258 probably benign Het
Negr1 A T 3: 157,069,276 K210* probably null Het
Nek7 A T 1: 138,498,574 probably null Het
Nktr T C 9: 121,752,768 probably benign Het
Nrxn2 A G 19: 6,490,081 T796A probably damaging Het
Nwd2 C A 5: 63,806,516 L1148I probably benign Het
Olfr1176 T C 2: 88,339,988 L141P probably damaging Het
Osmr G C 15: 6,842,881 T244S probably damaging Het
Ovol3 T C 7: 30,233,479 D177G possibly damaging Het
Pcdha4 G A 18: 36,954,702 R646H probably benign Het
Pdilt T C 7: 119,514,924 E117G possibly damaging Het
Pecr A G 1: 72,274,846 probably benign Het
Per3 G T 4: 151,041,302 L187I probably damaging Het
Plcl2 G A 17: 50,509,848 A81T probably benign Het
Polr2a T C 11: 69,747,275 N123D probably benign Het
Prex2 T A 1: 11,140,011 D558E possibly damaging Het
Psma5 T G 3: 108,268,070 V146G possibly damaging Het
Rgs11 A T 17: 26,202,973 M1L probably benign Het
Rgsl1 T C 1: 153,802,292 N130S probably benign Het
Rhbg T A 3: 88,245,468 T313S probably benign Het
Ripply2 T A 9: 87,015,638 probably benign Het
Scap T C 9: 110,381,633 V1011A probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Scarf1 G A 11: 75,515,580 G230D probably damaging Het
Slc17a8 A G 10: 89,589,494 probably null Het
Slc22a14 A T 9: 119,230,596 L153Q probably damaging Het
Slc22a27 A G 19: 7,879,455 I406T probably benign Het
Slc30a6 A G 17: 74,423,195 D355G probably benign Het
Socs7 A G 11: 97,378,026 D382G possibly damaging Het
Sphkap A G 1: 83,276,782 V1082A probably benign Het
Stox2 G A 8: 47,413,627 probably benign Het
Tacc2 T C 7: 130,733,528 S524P probably damaging Het
Tbc1d9b C T 11: 50,146,313 A263V probably benign Het
Tekt5 C T 16: 10,361,329 M391I probably benign Het
Tfap2b A T 1: 19,226,498 M222L probably benign Het
Themis2 T C 4: 132,782,933 D652G possibly damaging Het
Tmem185b A G 1: 119,527,592 probably benign Het
Trpv4 A G 5: 114,635,543 Y253H probably damaging Het
Trpv5 G A 6: 41,660,332 R358C probably benign Het
Ush2a G A 1: 188,728,381 G2613E probably benign Het
Usp25 C A 16: 77,050,558 Q185K probably damaging Het
Xkr5 G A 8: 18,933,468 probably benign Het
Zfp541 C T 7: 16,095,758 P1331S probably damaging Het
Other mutations in Cds1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Cds1 APN 5 101809901 missense probably damaging 0.99
IGL02052:Cds1 APN 5 101814472 missense probably benign 0.01
IGL02238:Cds1 APN 5 101814436 missense possibly damaging 0.84
IGL02449:Cds1 APN 5 101815928 missense probably damaging 1.00
IGL02833:Cds1 APN 5 101814466 missense possibly damaging 0.81
IGL02973:Cds1 APN 5 101812510 missense probably damaging 0.99
IGL02987:Cds1 APN 5 101812525 missense possibly damaging 0.85
R0076:Cds1 UTSW 5 101817840 splice site probably benign
R0200:Cds1 UTSW 5 101814433 missense probably damaging 0.97
R0285:Cds1 UTSW 5 101797038 missense probably damaging 1.00
R0608:Cds1 UTSW 5 101814433 missense probably damaging 0.97
R0932:Cds1 UTSW 5 101797025 missense probably damaging 0.99
R1444:Cds1 UTSW 5 101798379 missense probably damaging 1.00
R1585:Cds1 UTSW 5 101817962 splice site probably benign
R1781:Cds1 UTSW 5 101812550 missense possibly damaging 0.78
R2126:Cds1 UTSW 5 101812550 missense probably benign 0.34
R4804:Cds1 UTSW 5 101821523 missense probably damaging 1.00
R4990:Cds1 UTSW 5 101798379 missense probably damaging 1.00
R5176:Cds1 UTSW 5 101781420 missense possibly damaging 0.87
R5330:Cds1 UTSW 5 101798495 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCACATTTTGGATGGATTACC -3'
(R):5'- TTAAGACCACAGTGGGATAGC -3'

Sequencing Primer
(F):5'- AGGGACTGATTATGTCGTGTCAC -3'
(R):5'- GACCACAGTGGGATAGCTTTATATG -3'
Posted On2016-08-04