Incidental Mutation 'R5332:Spink5'
ID 423325
Institutional Source Beutler Lab
Gene Symbol Spink5
Ensembl Gene ENSMUSG00000055561
Gene Name serine peptidase inhibitor, Kazal type 5
Synonyms LEKT1, 2310065D10Rik
MMRRC Submission 042914-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5332 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 44096302-44155568 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 44125984 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 421 (E421G)
Ref Sequence ENSEMBL: ENSMUSP00000066214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069245]
AlphaFold Q148R4
Predicted Effect possibly damaging
Transcript: ENSMUST00000069245
AA Change: E421G

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066214
Gene: ENSMUSG00000055561
AA Change: E421G

DomainStartEndE-ValueType
PDB:1UUC|A 26 77 3e-6 PDB
KAZAL 97 152 1.67e-15 SMART
KAZAL 161 216 2.07e-3 SMART
KAZAL 226 281 3.37e-11 SMART
KAZAL 298 353 2.92e-6 SMART
KAZAL 367 424 6.73e-3 SMART
KAZAL 426 480 6.07e-4 SMART
KAZAL 496 558 2.43e-1 SMART
KAZAL 559 614 2.72e-15 SMART
KAZAL 633 687 1.95e-7 SMART
KAZAL 700 755 1.01e-9 SMART
KAZAL 769 824 7.29e-7 SMART
KAZAL 865 931 1.32e-4 SMART
KAZAL 942 996 2.74e-11 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may exhibit unique activities and specificities. These proteins may play a role in skin and hair morphogenesis, as well as anti-inflammatory and antimicrobial protection of mucous epithelia. Mutations in this gene may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. This gene is present in a gene cluster on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 G T 8: 87,251,459 (GRCm39) probably null Het
Ace T A 11: 105,864,705 (GRCm39) probably null Het
Bax T C 7: 45,116,195 (GRCm39) D2G probably damaging Het
Clec16a G A 16: 10,549,543 (GRCm39) C872Y probably damaging Het
Cmya5 T A 13: 93,232,703 (GRCm39) Y795F probably damaging Het
Coro2b T C 9: 62,336,512 (GRCm39) D254G probably damaging Het
Crhbp G T 13: 95,572,963 (GRCm39) P261H probably damaging Het
Cyp4f14 T C 17: 33,125,065 (GRCm39) D452G probably benign Het
Gm8444 T C 15: 81,727,902 (GRCm39) probably benign Het
Gria1 T A 11: 57,218,447 (GRCm39) M900K possibly damaging Het
Kcnj3 A G 2: 55,327,559 (GRCm39) H116R probably damaging Het
Lin9 T A 1: 180,496,763 (GRCm39) L351I probably benign Het
Map3k2 A G 18: 32,340,509 (GRCm39) D172G probably damaging Het
Mmp1b T C 9: 7,384,897 (GRCm39) I251V possibly damaging Het
Mpdz A C 4: 81,210,817 (GRCm39) H1689Q probably damaging Het
Mybpc3 C T 2: 90,953,283 (GRCm39) A176V probably damaging Het
Or5b124 A T 19: 13,610,729 (GRCm39) T85S possibly damaging Het
Otud7a T A 7: 63,385,574 (GRCm39) I352N probably damaging Het
Ptrh1 T C 2: 32,666,758 (GRCm39) V109A probably damaging Het
Pxn A G 5: 115,682,428 (GRCm39) T14A probably damaging Het
Rtn4 T A 11: 29,683,645 (GRCm39) L173Q probably damaging Het
Ryr3 A G 2: 112,733,038 (GRCm39) S603P probably damaging Het
Scara5 CG C 14: 65,997,111 (GRCm39) probably null Het
Scgb2b19 T C 7: 32,978,006 (GRCm39) N97S probably benign Het
Shank2 T A 7: 143,965,029 (GRCm39) I872N possibly damaging Het
Ush2a A G 1: 188,083,276 (GRCm39) Y273C probably damaging Het
Vmn2r121 T C X: 123,043,272 (GRCm39) T120A probably benign Het
Vmn2r52 T A 7: 9,903,052 (GRCm39) I459L probably benign Het
Zfp974 A C 7: 27,625,715 (GRCm39) S52A probably benign Het
Other mutations in Spink5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Spink5 APN 18 44,120,938 (GRCm39) splice site probably benign
IGL00332:Spink5 APN 18 44,100,111 (GRCm39) missense probably benign 0.00
IGL00501:Spink5 APN 18 44,110,806 (GRCm39) missense probably damaging 0.98
IGL00772:Spink5 APN 18 44,139,487 (GRCm39) missense probably benign 0.02
IGL00920:Spink5 APN 18 44,136,276 (GRCm39) missense probably damaging 1.00
IGL00980:Spink5 APN 18 44,140,777 (GRCm39) missense probably damaging 1.00
IGL01016:Spink5 APN 18 44,140,711 (GRCm39) missense probably damaging 1.00
IGL01155:Spink5 APN 18 44,114,214 (GRCm39) missense probably benign 0.01
IGL01374:Spink5 APN 18 44,122,471 (GRCm39) missense possibly damaging 0.74
IGL01629:Spink5 APN 18 44,129,677 (GRCm39) splice site probably benign
IGL01907:Spink5 APN 18 44,129,743 (GRCm39) missense probably damaging 1.00
IGL01931:Spink5 APN 18 44,148,705 (GRCm39) missense probably benign 0.02
IGL02237:Spink5 APN 18 44,145,934 (GRCm39) missense probably benign 0.03
IGL02306:Spink5 APN 18 44,097,511 (GRCm39) missense probably damaging 0.98
IGL02402:Spink5 APN 18 44,100,171 (GRCm39) missense probably damaging 1.00
IGL02425:Spink5 APN 18 44,123,811 (GRCm39) critical splice donor site probably null
IGL02552:Spink5 APN 18 44,125,235 (GRCm39) missense possibly damaging 0.80
IGL02554:Spink5 APN 18 44,148,661 (GRCm39) missense probably benign 0.01
IGL03066:Spink5 APN 18 44,149,457 (GRCm39) missense probably damaging 1.00
IGL03288:Spink5 APN 18 44,147,827 (GRCm39) missense possibly damaging 0.59
crusty2 UTSW 18 44,133,001 (GRCm39) splice site probably benign
R0079:Spink5 UTSW 18 44,110,831 (GRCm39) missense probably damaging 1.00
R0184:Spink5 UTSW 18 44,136,265 (GRCm39) missense probably benign 0.00
R0452:Spink5 UTSW 18 44,096,385 (GRCm39) missense possibly damaging 0.74
R0569:Spink5 UTSW 18 44,122,486 (GRCm39) missense probably damaging 1.00
R0639:Spink5 UTSW 18 44,146,042 (GRCm39) splice site probably null
R0648:Spink5 UTSW 18 44,132,864 (GRCm39) splice site probably benign
R0705:Spink5 UTSW 18 44,125,341 (GRCm39) missense probably benign 0.01
R1170:Spink5 UTSW 18 44,116,630 (GRCm39) missense probably benign 0.07
R1290:Spink5 UTSW 18 44,140,778 (GRCm39) missense probably damaging 0.99
R1345:Spink5 UTSW 18 44,123,749 (GRCm39) missense possibly damaging 0.88
R1458:Spink5 UTSW 18 44,140,786 (GRCm39) missense probably benign 0.01
R1530:Spink5 UTSW 18 44,148,738 (GRCm39) missense probably damaging 0.96
R1570:Spink5 UTSW 18 44,100,174 (GRCm39) missense probably benign 0.00
R1820:Spink5 UTSW 18 44,122,486 (GRCm39) missense possibly damaging 0.94
R1843:Spink5 UTSW 18 44,132,958 (GRCm39) missense probably benign 0.03
R1968:Spink5 UTSW 18 44,123,775 (GRCm39) missense probably benign 0.06
R2050:Spink5 UTSW 18 44,140,825 (GRCm39) critical splice donor site probably null
R2252:Spink5 UTSW 18 44,153,891 (GRCm39) nonsense probably null
R2278:Spink5 UTSW 18 44,119,396 (GRCm39) missense probably benign 0.07
R2279:Spink5 UTSW 18 44,119,396 (GRCm39) missense probably benign 0.07
R2696:Spink5 UTSW 18 44,115,359 (GRCm39) missense probably damaging 1.00
R2992:Spink5 UTSW 18 44,129,696 (GRCm39) missense probably damaging 1.00
R3422:Spink5 UTSW 18 44,143,311 (GRCm39) missense probably benign 0.01
R3934:Spink5 UTSW 18 44,149,494 (GRCm39) missense probably damaging 1.00
R4179:Spink5 UTSW 18 44,120,934 (GRCm39) missense probably benign
R4854:Spink5 UTSW 18 44,153,908 (GRCm39) makesense probably null
R5011:Spink5 UTSW 18 44,139,479 (GRCm39) missense probably damaging 0.97
R5133:Spink5 UTSW 18 44,119,490 (GRCm39) missense probably damaging 1.00
R5163:Spink5 UTSW 18 44,132,924 (GRCm39) missense possibly damaging 0.95
R5185:Spink5 UTSW 18 44,148,711 (GRCm39) missense probably damaging 0.97
R5187:Spink5 UTSW 18 44,122,518 (GRCm39) missense probably damaging 1.00
R5292:Spink5 UTSW 18 44,139,521 (GRCm39) missense probably benign
R5600:Spink5 UTSW 18 44,151,778 (GRCm39) missense probably damaging 0.96
R6267:Spink5 UTSW 18 44,147,824 (GRCm39) missense probably damaging 0.99
R6296:Spink5 UTSW 18 44,147,824 (GRCm39) missense probably damaging 0.99
R6373:Spink5 UTSW 18 44,123,739 (GRCm39) missense probably damaging 1.00
R6982:Spink5 UTSW 18 44,143,109 (GRCm39) splice site probably null
R6982:Spink5 UTSW 18 44,110,792 (GRCm39) missense probably damaging 1.00
R7332:Spink5 UTSW 18 44,115,317 (GRCm39) missense probably damaging 0.96
R7396:Spink5 UTSW 18 44,110,722 (GRCm39) missense possibly damaging 0.95
R7643:Spink5 UTSW 18 44,143,319 (GRCm39) missense probably benign 0.37
R7726:Spink5 UTSW 18 44,096,419 (GRCm39) missense probably damaging 1.00
R7828:Spink5 UTSW 18 44,143,296 (GRCm39) missense probably benign 0.15
R7836:Spink5 UTSW 18 44,132,888 (GRCm39) missense probably benign 0.00
R7880:Spink5 UTSW 18 44,119,393 (GRCm39) missense probably benign 0.40
R8031:Spink5 UTSW 18 44,143,303 (GRCm39) missense probably benign 0.07
R8198:Spink5 UTSW 18 44,125,947 (GRCm39) missense probably benign 0.17
R8361:Spink5 UTSW 18 44,122,529 (GRCm39) missense probably damaging 1.00
R8375:Spink5 UTSW 18 44,123,786 (GRCm39) missense probably benign 0.01
R8684:Spink5 UTSW 18 44,143,305 (GRCm39) missense probably benign 0.02
R8749:Spink5 UTSW 18 44,122,425 (GRCm39) nonsense probably null
R8918:Spink5 UTSW 18 44,100,087 (GRCm39) missense probably damaging 0.98
R9064:Spink5 UTSW 18 44,100,193 (GRCm39) missense probably damaging 1.00
R9161:Spink5 UTSW 18 44,147,986 (GRCm39) missense probably damaging 1.00
R9221:Spink5 UTSW 18 44,119,367 (GRCm39) missense probably damaging 1.00
R9292:Spink5 UTSW 18 44,148,075 (GRCm39) missense possibly damaging 0.91
R9545:Spink5 UTSW 18 44,136,262 (GRCm39) missense possibly damaging 0.88
R9784:Spink5 UTSW 18 44,119,490 (GRCm39) missense probably damaging 1.00
Z1177:Spink5 UTSW 18 44,129,764 (GRCm39) missense probably damaging 1.00
Z1177:Spink5 UTSW 18 44,129,702 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAAGCTTGGCGTTACAGGAC -3'
(R):5'- ACTAGCCATTGGTCTTACCTG -3'

Sequencing Primer
(F):5'- CGTTACAGGACTTTGGGGCC -3'
(R):5'- GTGCTCAAATTAGCCTTATGAGAAGC -3'
Posted On 2016-08-04