Incidental Mutation 'R5334:Gm11487'
ID423392
Institutional Source Beutler Lab
Gene Symbol Gm11487
Ensembl Gene ENSMUSG00000066137
Gene Namepredicted gene 11487
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R5334 (G1)
Quality Score107
Status Not validated
Chromosome4
Chromosomal Location73401032-73405072 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73403517 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 94 (M94L)
Ref Sequence ENSEMBL: ENSMUSP00000081520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084480]
Predicted Effect probably benign
Transcript: ENSMUST00000084480
AA Change: M94L

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000081520
Gene: ENSMUSG00000066137
AA Change: M94L

DomainStartEndE-ValueType
low complexity region 69 84 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147434
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to a family of related genes tandemly arranged in two clusters on chromosome 4. This family, which appears to be mouse-specific and composed of multiple highly similar members, is supported by limited transcript data. Members of the family maintain an intact open reading frame although the encoded protein has no known function. This gene is inferred from alignment of paralogous transcripts. [provided by RefSeq, Apr 2013]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ap4s1 C T 12: 51,738,671 S142L probably benign Het
Apol11a A G 15: 77,516,753 T147A probably benign Het
Aqp9 T C 9: 71,123,010 probably null Het
Arhgap25 T A 6: 87,463,261 N468I possibly damaging Het
Arhgef2 T A 3: 88,646,329 S924R probably damaging Het
Atad3a A T 4: 155,755,689 L144Q probably damaging Het
Ccbe1 T C 18: 66,083,245 I136V probably damaging Het
Col24a1 C A 3: 145,461,525 P1119Q possibly damaging Het
Dgkd T C 1: 87,938,267 probably null Het
Dnah7a A G 1: 53,503,646 I2455T probably benign Het
Dock2 T C 11: 34,228,643 T1795A probably benign Het
Dpp6 A T 5: 27,709,540 E541V probably benign Het
Edem1 T C 6: 108,848,832 probably null Het
Fbxo41 A G 6: 85,478,483 V573A probably damaging Het
Fech A C 18: 64,464,120 V256G probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gal3st4 T G 5: 138,265,721 K339Q probably benign Het
Gm884 T C 11: 103,613,873 Q2423R probably benign Het
Gpr158 T A 2: 21,827,505 S1139T probably benign Het
Gpr180 A T 14: 118,160,056 S321C probably damaging Het
Grik1 CGG CGGG 16: 87,923,194 probably null Het
Grin2c T G 11: 115,256,055 N438T possibly damaging Het
Hcn2 T C 10: 79,726,291 S374P probably damaging Het
Hmcn1 T A 1: 150,755,372 I892F probably damaging Het
Ifi207 C T 1: 173,727,531 V869I probably benign Het
Itgad T C 7: 128,189,286 Y390H probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnj15 A G 16: 95,296,649 K377E probably damaging Het
Kcnq3 A G 15: 66,025,224 S276P probably damaging Het
Klhl26 T C 8: 70,452,318 D280G probably damaging Het
Lmnb2 C T 10: 80,903,957 V376I probably benign Het
Mepce T A 5: 137,786,627 R29S probably benign Het
Mlh3 A G 12: 85,245,761 probably null Het
Mlip T A 9: 77,243,676 T33S probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Ncapg2 T C 12: 116,426,637 I402T probably damaging Het
Olfr1026 T C 2: 85,923,714 Y149H probably damaging Het
Olfr171 C G 16: 19,624,491 G203A probably benign Het
Pcsk5 T C 19: 17,461,851 D1301G probably benign Het
Pilrb1 T C 5: 137,854,903 M213V probably benign Het
Plxdc1 T C 11: 97,956,105 T163A possibly damaging Het
Pnpla2 T C 7: 141,459,493 L373P probably damaging Het
Prickle2 A G 6: 92,425,684 Y52H probably damaging Het
Rnf220 A G 4: 117,272,351 C294R probably damaging Het
Slc12a1 A G 2: 125,217,889 D903G probably damaging Het
Slc17a2 T C 13: 23,819,051 F228S probably damaging Het
Sptbn1 T C 11: 30,137,364 E1025G possibly damaging Het
Sult1c1 T G 17: 53,964,730 D143A probably damaging Het
Taar1 T G 10: 23,920,545 I47R probably damaging Het
Tctn3 G T 19: 40,602,822 Q514K probably benign Het
Tg T C 15: 66,678,055 F222S probably damaging Het
Tmem236 C A 2: 14,219,060 T220K possibly damaging Het
Trim50 C T 5: 135,367,476 T426M probably damaging Het
Vmn1r237 T C 17: 21,314,680 F222L probably benign Het
Wrap73 G A 4: 154,145,274 R34Q probably damaging Het
Zfp85 T C 13: 67,751,684 Y52C probably damaging Het
Other mutations in Gm11487
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02373:Gm11487 APN 4 73403643 missense probably benign 0.01
IGL03275:Gm11487 APN 4 73403416 missense possibly damaging 0.80
R1066:Gm11487 UTSW 4 73401829 missense possibly damaging 0.46
R1274:Gm11487 UTSW 4 73403076 missense probably damaging 0.97
R1742:Gm11487 UTSW 4 73401210 missense probably damaging 1.00
R1863:Gm11487 UTSW 4 73401800 nonsense probably null
R1903:Gm11487 UTSW 4 73403438 missense probably damaging 0.98
R2027:Gm11487 UTSW 4 73403058 missense possibly damaging 0.46
R4011:Gm11487 UTSW 4 73401810 missense probably damaging 0.97
R4801:Gm11487 UTSW 4 73401267 nonsense probably null
R4802:Gm11487 UTSW 4 73401267 nonsense probably null
R5213:Gm11487 UTSW 4 73401334 missense probably damaging 0.96
R5345:Gm11487 UTSW 4 73401277 missense probably damaging 1.00
R6093:Gm11487 UTSW 4 73402021 missense probably benign 0.05
R6786:Gm11487 UTSW 4 73403606 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GGCCTATGGGAAAAGGACTTGC -3'
(R):5'- TAGCCCTTGGACTGAGGATG -3'

Sequencing Primer
(F):5'- AAAGGACTTGCAGCAGTTGTGTC -3'
(R):5'- CCCTTGGACTGAGGATGAAATCTG -3'
Posted On2016-08-04