Incidental Mutation 'R5334:Dpp6'
ID423396
Institutional Source Beutler Lab
Gene Symbol Dpp6
Ensembl Gene ENSMUSG00000061576
Gene Namedipeptidylpeptidase 6
SynonymsRw, LOC384168, Peplb, Dpp-6, B930011P16Rik, In(5)6H-p
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5334 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location26817203-27727505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27709540 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 541 (E541V)
Ref Sequence ENSEMBL: ENSMUSP00000071435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071500] [ENSMUST00000101471] [ENSMUST00000120555] [ENSMUST00000122171]
Predicted Effect probably benign
Transcript: ENSMUST00000071500
AA Change: E541V

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000071435
Gene: ENSMUSG00000061576
AA Change: E541V

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
Pfam:DPPIV_N 134 500 7.2e-114 PFAM
Pfam:PD40 365 402 1.1e-5 PFAM
Pfam:Peptidase_S9 579 789 2.9e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101471
AA Change: E540V

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099012
Gene: ENSMUSG00000061576
AA Change: E540V

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
Pfam:DPPIV_N 133 499 2.6e-114 PFAM
Pfam:PD40 364 401 9.3e-6 PFAM
Pfam:Peptidase_S9 578 788 1.9e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120555
AA Change: E538V

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113849
Gene: ENSMUSG00000061576
AA Change: E538V

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
Pfam:DPPIV_N 131 497 2.6e-114 PFAM
Pfam:PD40 362 399 9.2e-6 PFAM
Pfam:Peptidase_S9 576 786 1.9e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122171
AA Change: E596V

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113441
Gene: ENSMUSG00000061576
AA Change: E596V

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
transmembrane domain 90 112 N/A INTRINSIC
Pfam:DPPIV_N 189 555 6.4e-113 PFAM
Pfam:PD40 425 457 1.1e-4 PFAM
Pfam:Peptidase_S9 634 844 4.3e-40 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the peptidase S9B family of serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Variations in this gene may be associated with susceptibility to amyotrophic lateral sclerosis and with idiopathic ventricular fibrillation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit loss of A-type K+ current gradients in distal dendrites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ap4s1 C T 12: 51,738,671 S142L probably benign Het
Apol11a A G 15: 77,516,753 T147A probably benign Het
Aqp9 T C 9: 71,123,010 probably null Het
Arhgap25 T A 6: 87,463,261 N468I possibly damaging Het
Arhgef2 T A 3: 88,646,329 S924R probably damaging Het
Atad3a A T 4: 155,755,689 L144Q probably damaging Het
Ccbe1 T C 18: 66,083,245 I136V probably damaging Het
Col24a1 C A 3: 145,461,525 P1119Q possibly damaging Het
Dgkd T C 1: 87,938,267 probably null Het
Dnah7a A G 1: 53,503,646 I2455T probably benign Het
Dock2 T C 11: 34,228,643 T1795A probably benign Het
Edem1 T C 6: 108,848,832 probably null Het
Fbxo41 A G 6: 85,478,483 V573A probably damaging Het
Fech A C 18: 64,464,120 V256G probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gal3st4 T G 5: 138,265,721 K339Q probably benign Het
Gm11487 T A 4: 73,403,517 M94L probably benign Het
Gm884 T C 11: 103,613,873 Q2423R probably benign Het
Gpr158 T A 2: 21,827,505 S1139T probably benign Het
Gpr180 A T 14: 118,160,056 S321C probably damaging Het
Grik1 CGG CGGG 16: 87,923,194 probably null Het
Grin2c T G 11: 115,256,055 N438T possibly damaging Het
Hcn2 T C 10: 79,726,291 S374P probably damaging Het
Hmcn1 T A 1: 150,755,372 I892F probably damaging Het
Ifi207 C T 1: 173,727,531 V869I probably benign Het
Itgad T C 7: 128,189,286 Y390H probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnj15 A G 16: 95,296,649 K377E probably damaging Het
Kcnq3 A G 15: 66,025,224 S276P probably damaging Het
Klhl26 T C 8: 70,452,318 D280G probably damaging Het
Lmnb2 C T 10: 80,903,957 V376I probably benign Het
Mepce T A 5: 137,786,627 R29S probably benign Het
Mlh3 A G 12: 85,245,761 probably null Het
Mlip T A 9: 77,243,676 T33S probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Ncapg2 T C 12: 116,426,637 I402T probably damaging Het
Olfr1026 T C 2: 85,923,714 Y149H probably damaging Het
Olfr171 C G 16: 19,624,491 G203A probably benign Het
Pcsk5 T C 19: 17,461,851 D1301G probably benign Het
Pilrb1 T C 5: 137,854,903 M213V probably benign Het
Plxdc1 T C 11: 97,956,105 T163A possibly damaging Het
Pnpla2 T C 7: 141,459,493 L373P probably damaging Het
Prickle2 A G 6: 92,425,684 Y52H probably damaging Het
Rnf220 A G 4: 117,272,351 C294R probably damaging Het
Slc12a1 A G 2: 125,217,889 D903G probably damaging Het
Slc17a2 T C 13: 23,819,051 F228S probably damaging Het
Sptbn1 T C 11: 30,137,364 E1025G possibly damaging Het
Sult1c1 T G 17: 53,964,730 D143A probably damaging Het
Taar1 T G 10: 23,920,545 I47R probably damaging Het
Tctn3 G T 19: 40,602,822 Q514K probably benign Het
Tg T C 15: 66,678,055 F222S probably damaging Het
Tmem236 C A 2: 14,219,060 T220K possibly damaging Het
Trim50 C T 5: 135,367,476 T426M probably damaging Het
Vmn1r237 T C 17: 21,314,680 F222L probably benign Het
Wrap73 G A 4: 154,145,274 R34Q probably damaging Het
Zfp85 T C 13: 67,751,684 Y52C probably damaging Het
Other mutations in Dpp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Dpp6 APN 5 27723443 missense probably damaging 1.00
IGL01137:Dpp6 APN 5 27714488 missense probably damaging 1.00
IGL01386:Dpp6 APN 5 27664762 critical splice donor site probably null
IGL01409:Dpp6 APN 5 27557601 missense probably damaging 1.00
IGL01721:Dpp6 APN 5 27631520 missense probably damaging 1.00
IGL02149:Dpp6 APN 5 27538024 missense probably benign 0.00
IGL02174:Dpp6 APN 5 27721087 nonsense probably null
IGL02176:Dpp6 APN 5 27723577 missense probably damaging 0.98
IGL02326:Dpp6 APN 5 27664757 missense probably damaging 1.00
IGL02336:Dpp6 APN 5 27469411 missense probably benign 0.04
IGL02339:Dpp6 APN 5 27652230 missense probably damaging 0.97
IGL02402:Dpp6 APN 5 27634543 missense probably damaging 1.00
IGL02884:Dpp6 APN 5 27634556 missense possibly damaging 0.88
IGL02885:Dpp6 APN 5 27718473 missense probably damaging 1.00
IGL02938:Dpp6 APN 5 27723367 splice site probably benign
IGL03083:Dpp6 APN 5 27709550 critical splice donor site probably null
I0000:Dpp6 UTSW 5 27398922 missense probably benign 0.02
IGL03052:Dpp6 UTSW 5 27709508 missense probably benign 0.03
PIT4431001:Dpp6 UTSW 5 27631498 missense probably benign 0.03
R0060:Dpp6 UTSW 5 27598819 missense probably damaging 1.00
R0360:Dpp6 UTSW 5 27652269 missense probably damaging 1.00
R0486:Dpp6 UTSW 5 27661642 missense probably benign 0.39
R0501:Dpp6 UTSW 5 27725606 missense probably damaging 1.00
R1028:Dpp6 UTSW 5 27666427 missense probably benign 0.01
R1164:Dpp6 UTSW 5 27721105 missense probably benign 0.02
R1177:Dpp6 UTSW 5 27663473 missense possibly damaging 0.94
R1993:Dpp6 UTSW 5 27399006 missense probably benign 0.00
R2024:Dpp6 UTSW 5 27709459 missense possibly damaging 0.67
R2100:Dpp6 UTSW 5 27664744 missense probably damaging 0.96
R2329:Dpp6 UTSW 5 27451288 splice site probably null
R3619:Dpp6 UTSW 5 27721120 missense possibly damaging 0.74
R3871:Dpp6 UTSW 5 27469465 missense probably benign 0.03
R3872:Dpp6 UTSW 5 27721058 missense probably damaging 1.00
R4114:Dpp6 UTSW 5 27469487 critical splice donor site probably null
R4403:Dpp6 UTSW 5 27718462 missense probably damaging 1.00
R4599:Dpp6 UTSW 5 27634548 missense probably damaging 1.00
R4736:Dpp6 UTSW 5 27712659 missense probably damaging 1.00
R4929:Dpp6 UTSW 5 27049787 missense probably benign 0.25
R4967:Dpp6 UTSW 5 27666511 missense probably damaging 1.00
R5162:Dpp6 UTSW 5 27399015 unclassified probably benign
R5270:Dpp6 UTSW 5 27634534 missense probably damaging 0.98
R5437:Dpp6 UTSW 5 27663501 nonsense probably null
R5663:Dpp6 UTSW 5 27049622 missense possibly damaging 0.84
R6023:Dpp6 UTSW 5 27723547 missense probably damaging 0.96
R6244:Dpp6 UTSW 5 27049628 missense probably damaging 0.99
R6312:Dpp6 UTSW 5 27725671 missense possibly damaging 0.84
R6442:Dpp6 UTSW 5 27718509 critical splice donor site probably null
R6942:Dpp6 UTSW 5 27469459 missense possibly damaging 0.79
R6956:Dpp6 UTSW 5 27598821 missense probably damaging 1.00
R7210:Dpp6 UTSW 5 27598803 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTGATACTAGGGCCCCAGG -3'
(R):5'- AAAGGCTCTGTCCTGCTGTC -3'

Sequencing Primer
(F):5'- CCCAGGTCTTGAATGAGCTATCTG -3'
(R):5'- TCTTCAGGGGAGGAATCATAAATCTG -3'
Posted On2016-08-04