Incidental Mutation 'R5334:Gal3st4'
ID423403
Institutional Source Beutler Lab
Gene Symbol Gal3st4
Ensembl Gene ENSMUSG00000075593
Gene Namegalactose-3-O-sulfotransferase 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5334 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location138264921-138272840 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 138265721 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 339 (K339Q)
Ref Sequence ENSEMBL: ENSMUSP00000124841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048421] [ENSMUST00000100530] [ENSMUST00000159067] [ENSMUST00000159123] [ENSMUST00000159146] [ENSMUST00000159649] [ENSMUST00000161279] [ENSMUST00000161647]
Predicted Effect probably benign
Transcript: ENSMUST00000048421
SMART Domains Protein: ENSMUSP00000046898
Gene: ENSMUSG00000036948

DomainStartEndE-ValueType
low complexity region 53 71 N/A INTRINSIC
low complexity region 75 93 N/A INTRINSIC
low complexity region 95 114 N/A INTRINSIC
low complexity region 215 225 N/A INTRINSIC
low complexity region 488 502 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100530
AA Change: K339Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000098099
Gene: ENSMUSG00000075593
AA Change: K339Q

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 2 231 1.1e-57 PFAM
Pfam:Gal-3-0_sulfotr 270 463 1e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144460
Predicted Effect probably benign
Transcript: ENSMUST00000159067
SMART Domains Protein: ENSMUSP00000125178
Gene: ENSMUSG00000106247

DomainStartEndE-ValueType
Pfam:Glypican 7 250 1e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159123
SMART Domains Protein: ENSMUSP00000137679
Gene: ENSMUSG00000036948

DomainStartEndE-ValueType
low complexity region 53 71 N/A INTRINSIC
low complexity region 75 93 N/A INTRINSIC
low complexity region 95 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159534
Predicted Effect probably benign
Transcript: ENSMUST00000159649
SMART Domains Protein: ENSMUSP00000125208
Gene: ENSMUSG00000036948

DomainStartEndE-ValueType
low complexity region 219 233 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159872
Predicted Effect probably benign
Transcript: ENSMUST00000161279
AA Change: K339Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000124841
Gene: ENSMUSG00000075593
AA Change: K339Q

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 2 231 1.1e-57 PFAM
Pfam:Gal-3-0_sulfotr 270 463 1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161647
AA Change: K334Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000125084
Gene: ENSMUSG00000075593
AA Change: K334Q

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 4 226 5.3e-58 PFAM
Pfam:Gal-3-0_sulfotr 265 458 3.8e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162632
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the galactose-3-O-sulfotransferase protein family. The product of this gene catalyzes sulfonation by transferring a sulfate to the C-3' position of galactose residues in O-linked glycoproteins. This enzyme is highly specific for core 1 structures, with asialofetuin, Gal-beta-1,3-GalNAc and Gal-beta-1,3 (GlcNAc-beta-1,6)GalNAc being good substrates. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ap4s1 C T 12: 51,738,671 S142L probably benign Het
Apol11a A G 15: 77,516,753 T147A probably benign Het
Aqp9 T C 9: 71,123,010 probably null Het
Arhgap25 T A 6: 87,463,261 N468I possibly damaging Het
Arhgef2 T A 3: 88,646,329 S924R probably damaging Het
Atad3a A T 4: 155,755,689 L144Q probably damaging Het
Ccbe1 T C 18: 66,083,245 I136V probably damaging Het
Col24a1 C A 3: 145,461,525 P1119Q possibly damaging Het
Dgkd T C 1: 87,938,267 probably null Het
Dnah7a A G 1: 53,503,646 I2455T probably benign Het
Dock2 T C 11: 34,228,643 T1795A probably benign Het
Dpp6 A T 5: 27,709,540 E541V probably benign Het
Edem1 T C 6: 108,848,832 probably null Het
Fbxo41 A G 6: 85,478,483 V573A probably damaging Het
Fech A C 18: 64,464,120 V256G probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm11487 T A 4: 73,403,517 M94L probably benign Het
Gm884 T C 11: 103,613,873 Q2423R probably benign Het
Gpr158 T A 2: 21,827,505 S1139T probably benign Het
Gpr180 A T 14: 118,160,056 S321C probably damaging Het
Grik1 CGG CGGG 16: 87,923,194 probably null Het
Grin2c T G 11: 115,256,055 N438T possibly damaging Het
Hcn2 T C 10: 79,726,291 S374P probably damaging Het
Hmcn1 T A 1: 150,755,372 I892F probably damaging Het
Ifi207 C T 1: 173,727,531 V869I probably benign Het
Itgad T C 7: 128,189,286 Y390H probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnj15 A G 16: 95,296,649 K377E probably damaging Het
Kcnq3 A G 15: 66,025,224 S276P probably damaging Het
Klhl26 T C 8: 70,452,318 D280G probably damaging Het
Lmnb2 C T 10: 80,903,957 V376I probably benign Het
Mepce T A 5: 137,786,627 R29S probably benign Het
Mlh3 A G 12: 85,245,761 probably null Het
Mlip T A 9: 77,243,676 T33S probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Ncapg2 T C 12: 116,426,637 I402T probably damaging Het
Olfr1026 T C 2: 85,923,714 Y149H probably damaging Het
Olfr171 C G 16: 19,624,491 G203A probably benign Het
Pcsk5 T C 19: 17,461,851 D1301G probably benign Het
Pilrb1 T C 5: 137,854,903 M213V probably benign Het
Plxdc1 T C 11: 97,956,105 T163A possibly damaging Het
Pnpla2 T C 7: 141,459,493 L373P probably damaging Het
Prickle2 A G 6: 92,425,684 Y52H probably damaging Het
Rnf220 A G 4: 117,272,351 C294R probably damaging Het
Slc12a1 A G 2: 125,217,889 D903G probably damaging Het
Slc17a2 T C 13: 23,819,051 F228S probably damaging Het
Sptbn1 T C 11: 30,137,364 E1025G possibly damaging Het
Sult1c1 T G 17: 53,964,730 D143A probably damaging Het
Taar1 T G 10: 23,920,545 I47R probably damaging Het
Tctn3 G T 19: 40,602,822 Q514K probably benign Het
Tg T C 15: 66,678,055 F222S probably damaging Het
Tmem236 C A 2: 14,219,060 T220K possibly damaging Het
Trim50 C T 5: 135,367,476 T426M probably damaging Het
Vmn1r237 T C 17: 21,314,680 F222L probably benign Het
Wrap73 G A 4: 154,145,274 R34Q probably damaging Het
Zfp85 T C 13: 67,751,684 Y52C probably damaging Het
Other mutations in Gal3st4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Gal3st4 APN 5 138271402 start codon destroyed probably null 0.99
IGL01916:Gal3st4 APN 5 138270935 missense probably damaging 1.00
IGL02724:Gal3st4 APN 5 138265417 missense probably benign 0.30
IGL02978:Gal3st4 APN 5 138265669 missense probably damaging 1.00
R0506:Gal3st4 UTSW 5 138265889 missense probably benign 0.19
R1858:Gal3st4 UTSW 5 138270788 unclassified probably null
R1914:Gal3st4 UTSW 5 138265410 missense probably benign 0.08
R1915:Gal3st4 UTSW 5 138265410 missense probably benign 0.08
R4615:Gal3st4 UTSW 5 138266263 missense probably damaging 0.97
R4805:Gal3st4 UTSW 5 138265471 unclassified probably null
R5442:Gal3st4 UTSW 5 138265780 missense possibly damaging 0.71
R6913:Gal3st4 UTSW 5 138270828 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TTTGGGGTCTAAAGCCTCACC -3'
(R):5'- CTTTATCCAATGGGGTCTGGC -3'

Sequencing Primer
(F):5'- AGCAACGTTTAGCCAGAGC -3'
(R):5'- CCTGGTTGGACTCAGTCTTTGAC -3'
Posted On2016-08-04