Incidental Mutation 'R0487:Zfp609'
ID42347
Institutional Source Beutler Lab
Gene Symbol Zfp609
Ensembl Gene ENSMUSG00000040524
Gene Namezinc finger protein 609
Synonyms
MMRRC Submission 038686-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R0487 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location65692391-65827564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 65702634 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1016 (Q1016K)
Ref Sequence ENSEMBL: ENSMUSP00000124089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159109]
Predicted Effect unknown
Transcript: ENSMUST00000159109
AA Change: Q1016K
SMART Domains Protein: ENSMUSP00000124089
Gene: ENSMUSG00000040524
AA Change: Q1016K

DomainStartEndE-ValueType
low complexity region 83 101 N/A INTRINSIC
low complexity region 125 139 N/A INTRINSIC
low complexity region 155 176 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 386 405 N/A INTRINSIC
ZnF_C2H2 495 520 2.14e0 SMART
low complexity region 629 638 N/A INTRINSIC
low complexity region 657 667 N/A INTRINSIC
low complexity region 724 738 N/A INTRINSIC
low complexity region 1000 1020 N/A INTRINSIC
low complexity region 1210 1219 N/A INTRINSIC
low complexity region 1257 1273 N/A INTRINSIC
low complexity region 1329 1348 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159878
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,331,687 M3190L probably benign Het
Adgrv1 A T 13: 81,489,035 L3429H probably damaging Het
Ahnak A G 19: 9,007,151 N1933S probably benign Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
AI314180 A G 4: 58,819,155 V1265A probably damaging Het
Amacr A G 15: 10,984,749 D151G probably benign Het
Ano9 A T 7: 141,107,849 H255Q possibly damaging Het
Asphd2 A T 5: 112,391,635 Y111N probably damaging Het
Cage1 T A 13: 38,025,358 K214N probably benign Het
Cdkn2c A G 4: 109,661,409 L116P probably damaging Het
Cltc C T 11: 86,733,664 R148H probably damaging Het
Cmbl A G 15: 31,582,030 N58D probably damaging Het
Cpa6 T C 1: 10,409,262 T249A possibly damaging Het
Cpsf1 T A 15: 76,597,002 N1218I probably damaging Het
Csf2rb T C 15: 78,348,331 S613P probably benign Het
Ctnnd1 A G 2: 84,609,067 S761P probably damaging Het
Cxcr6 A C 9: 123,810,398 I155L probably benign Het
Fam216a A G 5: 122,370,513 probably null Het
Fgf10 T A 13: 118,781,611 probably null Het
Fgf17 T C 14: 70,638,556 T79A probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm1527 G T 3: 28,926,679 V643L probably benign Het
Gm7534 A T 4: 134,202,778 L72Q probably damaging Het
Hmcn2 A T 2: 31,386,677 Q1556L possibly damaging Het
Hrasls G A 16: 29,220,579 probably null Het
Hspa4l C T 3: 40,784,326 T616I possibly damaging Het
Irgm1 T C 11: 48,866,327 D219G probably damaging Het
Jcad A G 18: 4,673,243 D335G probably damaging Het
Kcnh4 A G 11: 100,750,258 F455S probably damaging Het
Khdrbs3 T C 15: 69,017,361 Y120H probably damaging Het
Kndc1 A T 7: 139,914,023 T507S probably null Het
Lepr G T 4: 101,768,093 E482* probably null Het
Lrmp A G 6: 145,165,260 S264G probably benign Het
Mcemp1 T A 8: 3,667,507 M146K probably benign Het
Mllt10 A G 2: 18,207,137 T411A probably damaging Het
Myh8 A T 11: 67,302,011 I1543L probably benign Het
Myo1f T C 17: 33,578,284 S147P probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Olfr1106 C T 2: 87,048,493 V248I probably damaging Het
Plch2 G A 4: 155,009,012 R57C probably damaging Het
Rbm20 G A 19: 53,851,195 G872R probably damaging Het
Retsat A T 6: 72,606,431 I373F probably damaging Het
Rnf145 T C 11: 44,555,229 F297L probably benign Het
Ros1 A T 10: 52,155,108 M479K possibly damaging Het
Rubcnl T A 14: 75,036,081 N244K probably benign Het
Samhd1 A G 2: 157,110,615 F406L probably damaging Het
Sdsl A T 5: 120,459,468 V258D probably damaging Het
Sec24c C G 14: 20,683,399 P166A probably benign Het
Sele C A 1: 164,053,615 Y461* probably null Het
Slc22a1 G T 17: 12,662,600 S334* probably null Het
Spem1 T G 11: 69,821,865 probably null Het
Stat3 T C 11: 100,903,643 E280G probably damaging Het
Stxbp4 T C 11: 90,592,360 H280R probably benign Het
Tas2r129 G A 6: 132,951,943 C281Y probably benign Het
Tas2r129 T G 6: 132,951,944 C281W probably benign Het
Tcp11 T A 17: 28,079,923 probably null Het
Tnrc6b G A 15: 80,880,675 V793M probably benign Het
Vmn2r59 A C 7: 42,047,104 Y71* probably null Het
Wdr35 T C 12: 9,012,743 probably null Het
Zan A G 5: 137,413,358 probably null Het
Zap70 G T 1: 36,779,284 V351L probably damaging Het
Zfp641 C A 15: 98,289,179 V188L probably benign Het
Other mutations in Zfp609
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00956:Zfp609 APN 9 65702763 missense probably benign 0.18
IGL01688:Zfp609 APN 9 65704025 missense probably benign
IGL01718:Zfp609 APN 9 65702400 nonsense probably null
IGL01860:Zfp609 APN 9 65702834 missense possibly damaging 0.82
IGL02441:Zfp609 APN 9 65703329 missense possibly damaging 0.92
IGL02490:Zfp609 APN 9 65703968 missense possibly damaging 0.92
IGL02614:Zfp609 APN 9 65702790 missense probably damaging 0.96
IGL02794:Zfp609 APN 9 65704320 missense possibly damaging 0.83
IGL02959:Zfp609 APN 9 65703393 missense probably benign
IGL02967:Zfp609 APN 9 65697619 missense possibly damaging 0.83
IGL03036:Zfp609 APN 9 65702645 missense possibly damaging 0.89
IGL03182:Zfp609 APN 9 65701005 missense probably benign 0.02
H8441:Zfp609 UTSW 9 65794887 missense possibly damaging 0.82
R0304:Zfp609 UTSW 9 65701188 missense possibly damaging 0.89
R0505:Zfp609 UTSW 9 65703462 missense possibly damaging 0.92
R0684:Zfp609 UTSW 9 65731201 missense probably benign 0.01
R1480:Zfp609 UTSW 9 65703311 missense possibly damaging 0.82
R1507:Zfp609 UTSW 9 65794777 missense possibly damaging 0.92
R1579:Zfp609 UTSW 9 65704472 missense possibly damaging 0.90
R1655:Zfp609 UTSW 9 65703554 missense possibly damaging 0.46
R1692:Zfp609 UTSW 9 65795311 missense probably damaging 0.98
R1701:Zfp609 UTSW 9 65731000 missense probably benign 0.05
R1735:Zfp609 UTSW 9 65703092 nonsense probably null
R1883:Zfp609 UTSW 9 65794758 missense probably benign
R1970:Zfp609 UTSW 9 65795277 missense probably damaging 0.96
R2059:Zfp609 UTSW 9 65704434 missense possibly damaging 0.83
R2302:Zfp609 UTSW 9 65794897 missense possibly damaging 0.66
R3404:Zfp609 UTSW 9 65701172 missense possibly damaging 0.68
R3405:Zfp609 UTSW 9 65701172 missense possibly damaging 0.68
R4514:Zfp609 UTSW 9 65703695 missense possibly damaging 0.46
R4533:Zfp609 UTSW 9 65703608 missense probably benign 0.00
R5043:Zfp609 UTSW 9 65700827 missense probably damaging 0.97
R5499:Zfp609 UTSW 9 65702855 missense probably benign 0.00
R7081:Zfp609 UTSW 9 65702441 missense possibly damaging 0.46
X0028:Zfp609 UTSW 9 65697080 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TTGGGAATGATGACAGACTTGGCAG -3'
(R):5'- TCCACGTAGTGACCCAGAATGGAG -3'

Sequencing Primer
(F):5'- ACTTGGCAGGATCTGTCCC -3'
(R):5'- TCCAGGTTATGCACAGTCCAG -3'
Posted On2013-05-23