Incidental Mutation 'R0487:Ros1'
ID42349
Institutional Source Beutler Lab
Gene Symbol Ros1
Ensembl Gene ENSMUSG00000019893
Gene NameRos1 proto-oncogene
SynonymsRos-1, c-ros
MMRRC Submission 038686-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R0487 (G1)
Quality Score129
Status Not validated
Chromosome10
Chromosomal Location52045721-52195244 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52155108 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 479 (M479K)
Ref Sequence ENSEMBL: ENSMUSP00000151932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020045] [ENSMUST00000218452] [ENSMUST00000219173] [ENSMUST00000219692]
Predicted Effect probably benign
Transcript: ENSMUST00000020045
AA Change: M488K

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020045
Gene: ENSMUSG00000019893
AA Change: M488K

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 568 654 2.24e-4 SMART
LY 734 776 2.28e1 SMART
LY 777 815 4.61e0 SMART
FN3 944 1023 5.53e-4 SMART
FN3 1037 1133 1.07e1 SMART
FN3 1440 1532 1.19e1 SMART
FN3 1551 1637 2.11e0 SMART
FN3 1649 1731 6.8e-4 SMART
FN3 1746 1832 2.7e1 SMART
TyrKc 1938 2208 1.3e-145 SMART
low complexity region 2294 2307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117992
AA Change: M467K

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112873
Gene: ENSMUSG00000019893
AA Change: M467K

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 547 633 2.24e-4 SMART
LY 713 755 2.28e1 SMART
LY 756 794 4.61e0 SMART
FN3 923 1002 5.53e-4 SMART
FN3 1016 1112 1.07e1 SMART
FN3 1419 1511 1.19e1 SMART
FN3 1530 1616 2.11e0 SMART
FN3 1628 1710 6.8e-4 SMART
FN3 1725 1811 2.7e1 SMART
TyrKc 1917 2187 1.3e-145 SMART
low complexity region 2273 2286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175892
AA Change: M479K

PolyPhen 2 Score 0.425 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135235
Gene: ENSMUSG00000019893
AA Change: M479K

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 100 178 1.05e-4 SMART
FN3 196 273 7.45e-10 SMART
Blast:LY 360 400 1e-20 BLAST
Blast:LY 449 486 4e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177378
AA Change: M467K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000134905
Gene: ENSMUSG00000019893
AA Change: M467K

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 547 633 2.24e-4 SMART
LY 713 755 2.28e1 SMART
LY 756 794 4.61e0 SMART
FN3 923 1002 5.53e-4 SMART
FN3 1016 1112 1.07e1 SMART
Blast:LY 1190 1236 2e-18 BLAST
FN3 1419 1511 1.19e1 SMART
FN3 1530 1616 2.11e0 SMART
FN3 1628 1710 6.8e-4 SMART
FN3 1725 1811 2.7e1 SMART
transmembrane domain 1832 1854 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000218452
AA Change: M467K

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000219173
AA Change: M467K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219692
AA Change: M479K

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This proto-oncogene, highly-expressed in a variety of tumor cell lines, belongs to the sevenless subfamily of tyrosine kinase insulin receptor genes. The protein encoded by this gene is a type I integral membrane protein with tyrosine kinase activity. The protein may function as a growth or differentiation factor receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit male infertility due to impaired sperm maturation in the epididymis. Mutant sperm are capable of fertilization in vitro but not in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,331,687 M3190L probably benign Het
Adgrv1 A T 13: 81,489,035 L3429H probably damaging Het
Ahnak A G 19: 9,007,151 N1933S probably benign Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
AI314180 A G 4: 58,819,155 V1265A probably damaging Het
Amacr A G 15: 10,984,749 D151G probably benign Het
Ano9 A T 7: 141,107,849 H255Q possibly damaging Het
Asphd2 A T 5: 112,391,635 Y111N probably damaging Het
Cage1 T A 13: 38,025,358 K214N probably benign Het
Cdkn2c A G 4: 109,661,409 L116P probably damaging Het
Cltc C T 11: 86,733,664 R148H probably damaging Het
Cmbl A G 15: 31,582,030 N58D probably damaging Het
Cpa6 T C 1: 10,409,262 T249A possibly damaging Het
Cpsf1 T A 15: 76,597,002 N1218I probably damaging Het
Csf2rb T C 15: 78,348,331 S613P probably benign Het
Ctnnd1 A G 2: 84,609,067 S761P probably damaging Het
Cxcr6 A C 9: 123,810,398 I155L probably benign Het
Fam216a A G 5: 122,370,513 probably null Het
Fgf10 T A 13: 118,781,611 probably null Het
Fgf17 T C 14: 70,638,556 T79A probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm1527 G T 3: 28,926,679 V643L probably benign Het
Gm7534 A T 4: 134,202,778 L72Q probably damaging Het
Hmcn2 A T 2: 31,386,677 Q1556L possibly damaging Het
Hrasls G A 16: 29,220,579 probably null Het
Hspa4l C T 3: 40,784,326 T616I possibly damaging Het
Irgm1 T C 11: 48,866,327 D219G probably damaging Het
Jcad A G 18: 4,673,243 D335G probably damaging Het
Kcnh4 A G 11: 100,750,258 F455S probably damaging Het
Khdrbs3 T C 15: 69,017,361 Y120H probably damaging Het
Kndc1 A T 7: 139,914,023 T507S probably null Het
Lepr G T 4: 101,768,093 E482* probably null Het
Lrmp A G 6: 145,165,260 S264G probably benign Het
Mcemp1 T A 8: 3,667,507 M146K probably benign Het
Mllt10 A G 2: 18,207,137 T411A probably damaging Het
Myh8 A T 11: 67,302,011 I1543L probably benign Het
Myo1f T C 17: 33,578,284 S147P probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Olfr1106 C T 2: 87,048,493 V248I probably damaging Het
Plch2 G A 4: 155,009,012 R57C probably damaging Het
Rbm20 G A 19: 53,851,195 G872R probably damaging Het
Retsat A T 6: 72,606,431 I373F probably damaging Het
Rnf145 T C 11: 44,555,229 F297L probably benign Het
Rubcnl T A 14: 75,036,081 N244K probably benign Het
Samhd1 A G 2: 157,110,615 F406L probably damaging Het
Sdsl A T 5: 120,459,468 V258D probably damaging Het
Sec24c C G 14: 20,683,399 P166A probably benign Het
Sele C A 1: 164,053,615 Y461* probably null Het
Slc22a1 G T 17: 12,662,600 S334* probably null Het
Spem1 T G 11: 69,821,865 probably null Het
Stat3 T C 11: 100,903,643 E280G probably damaging Het
Stxbp4 T C 11: 90,592,360 H280R probably benign Het
Tas2r129 G A 6: 132,951,943 C281Y probably benign Het
Tas2r129 T G 6: 132,951,944 C281W probably benign Het
Tcp11 T A 17: 28,079,923 probably null Het
Tnrc6b G A 15: 80,880,675 V793M probably benign Het
Vmn2r59 A C 7: 42,047,104 Y71* probably null Het
Wdr35 T C 12: 9,012,743 probably null Het
Zan A G 5: 137,413,358 probably null Het
Zap70 G T 1: 36,779,284 V351L probably damaging Het
Zfp609 G T 9: 65,702,634 Q1016K unknown Het
Zfp641 C A 15: 98,289,179 V188L probably benign Het
Other mutations in Ros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ros1 APN 10 52194890 missense probably benign 0.01
IGL00338:Ros1 APN 10 52125811 missense probably benign
IGL00419:Ros1 APN 10 52091054 missense probably damaging 0.97
IGL00840:Ros1 APN 10 52144873 missense possibly damaging 0.92
IGL00841:Ros1 APN 10 52144873 missense possibly damaging 0.92
IGL00951:Ros1 APN 10 52143252 missense probably damaging 0.99
IGL01123:Ros1 APN 10 52120809 missense probably damaging 1.00
IGL01128:Ros1 APN 10 52142328 nonsense probably null
IGL01300:Ros1 APN 10 52101713 missense probably benign 0.01
IGL01316:Ros1 APN 10 52087879 critical splice donor site probably null
IGL01349:Ros1 APN 10 52051026 missense probably damaging 0.99
IGL01363:Ros1 APN 10 52166142 missense probably damaging 1.00
IGL01457:Ros1 APN 10 52046330 splice site probably benign
IGL01532:Ros1 APN 10 52090938 splice site probably benign
IGL01585:Ros1 APN 10 52155102 missense probably damaging 1.00
IGL01650:Ros1 APN 10 52154979 missense probably damaging 0.99
IGL01672:Ros1 APN 10 52101803 missense possibly damaging 0.92
IGL01904:Ros1 APN 10 52077911 missense probably damaging 0.97
IGL02040:Ros1 APN 10 52115922 missense probably damaging 0.99
IGL02053:Ros1 APN 10 52162720 missense probably damaging 1.00
IGL02147:Ros1 APN 10 52120895 missense probably damaging 1.00
IGL02169:Ros1 APN 10 52081957 critical splice donor site probably null
IGL02247:Ros1 APN 10 52129581 missense probably damaging 0.99
IGL02262:Ros1 APN 10 52178969 missense probably damaging 0.96
IGL02307:Ros1 APN 10 52128438 missense possibly damaging 0.53
IGL02398:Ros1 APN 10 52144884 splice site probably benign
IGL02525:Ros1 APN 10 52116042 missense possibly damaging 0.66
IGL02718:Ros1 APN 10 52118232 missense probably damaging 1.00
IGL02721:Ros1 APN 10 52172831 splice site probably benign
IGL02808:Ros1 APN 10 52125889 missense probably damaging 1.00
IGL03009:Ros1 APN 10 52145907 missense probably benign 0.00
IGL03035:Ros1 APN 10 52075984 splice site probably benign
IGL03092:Ros1 APN 10 52098806 missense probably damaging 0.99
IGL03309:Ros1 APN 10 52118261 missense possibly damaging 0.83
IGL03333:Ros1 APN 10 52155171 missense probably damaging 1.00
R0049:Ros1 UTSW 10 52101761 missense possibly damaging 0.66
R0049:Ros1 UTSW 10 52101761 missense possibly damaging 0.66
R0050:Ros1 UTSW 10 52101803 missense probably damaging 0.97
R0050:Ros1 UTSW 10 52101803 missense probably damaging 0.97
R0057:Ros1 UTSW 10 52180191 missense probably benign 0.00
R0057:Ros1 UTSW 10 52180191 missense probably benign 0.00
R0106:Ros1 UTSW 10 52142267 missense possibly damaging 0.85
R0106:Ros1 UTSW 10 52142267 missense possibly damaging 0.85
R0125:Ros1 UTSW 10 52125789 missense probably benign 0.38
R0403:Ros1 UTSW 10 52143438 splice site probably benign
R0502:Ros1 UTSW 10 52194823 splice site probably benign
R0557:Ros1 UTSW 10 52085263 missense possibly damaging 0.82
R0599:Ros1 UTSW 10 52123300 missense probably damaging 1.00
R0620:Ros1 UTSW 10 52118348 missense probably damaging 1.00
R0679:Ros1 UTSW 10 52066295 missense possibly damaging 0.95
R1005:Ros1 UTSW 10 52128405 splice site probably benign
R1073:Ros1 UTSW 10 52046125 missense probably damaging 1.00
R1220:Ros1 UTSW 10 52098870 missense probably damaging 0.97
R1279:Ros1 UTSW 10 52142166 missense possibly damaging 0.81
R1295:Ros1 UTSW 10 52087932 missense possibly damaging 0.92
R1336:Ros1 UTSW 10 52168662 missense probably damaging 1.00
R1371:Ros1 UTSW 10 52087945 missense probably damaging 0.98
R1447:Ros1 UTSW 10 52098858 missense possibly damaging 0.66
R1486:Ros1 UTSW 10 52172858 missense probably damaging 1.00
R1499:Ros1 UTSW 10 52098677 missense possibly damaging 0.92
R1669:Ros1 UTSW 10 52161811 missense probably damaging 1.00
R1744:Ros1 UTSW 10 52123379 missense probably damaging 0.99
R1759:Ros1 UTSW 10 52120826 missense probably damaging 1.00
R1791:Ros1 UTSW 10 52100087 missense probably benign 0.00
R1794:Ros1 UTSW 10 52124103 nonsense probably null
R2031:Ros1 UTSW 10 52067068 missense possibly damaging 0.88
R2115:Ros1 UTSW 10 52128555 missense probably benign 0.00
R2219:Ros1 UTSW 10 52166079 missense probably damaging 1.00
R2290:Ros1 UTSW 10 52118381 missense probably damaging 0.96
R2329:Ros1 UTSW 10 52162887 missense probably damaging 1.00
R2371:Ros1 UTSW 10 52163895 missense possibly damaging 0.66
R2879:Ros1 UTSW 10 52172840 critical splice donor site probably null
R3154:Ros1 UTSW 10 52050981 missense probably benign
R3423:Ros1 UTSW 10 52128416 unclassified probably null
R3424:Ros1 UTSW 10 52128416 unclassified probably null
R3425:Ros1 UTSW 10 52128416 unclassified probably null
R3433:Ros1 UTSW 10 52091108 missense probably benign 0.45
R3522:Ros1 UTSW 10 52090995 nonsense probably null
R3686:Ros1 UTSW 10 52145816 missense probably damaging 1.00
R3710:Ros1 UTSW 10 52161895 nonsense probably null
R3771:Ros1 UTSW 10 52128991 missense probably damaging 0.97
R3808:Ros1 UTSW 10 52120848 missense probably benign 0.08
R3930:Ros1 UTSW 10 52194848 missense possibly damaging 0.92
R3950:Ros1 UTSW 10 52066388 missense probably damaging 1.00
R3981:Ros1 UTSW 10 52120878 missense possibly damaging 0.46
R4007:Ros1 UTSW 10 52118232 missense probably damaging 1.00
R4346:Ros1 UTSW 10 52168609 missense possibly damaging 0.92
R4382:Ros1 UTSW 10 52120959 missense possibly damaging 0.46
R4414:Ros1 UTSW 10 52162704 critical splice donor site probably null
R4450:Ros1 UTSW 10 52077942 missense probably damaging 0.98
R4468:Ros1 UTSW 10 52118356 missense probably damaging 1.00
R4569:Ros1 UTSW 10 52163994 missense probably damaging 0.99
R4649:Ros1 UTSW 10 52129668 missense possibly damaging 0.66
R4684:Ros1 UTSW 10 52129096 missense probably damaging 1.00
R4706:Ros1 UTSW 10 52101894 missense possibly damaging 0.95
R4731:Ros1 UTSW 10 52142229 missense probably damaging 1.00
R4748:Ros1 UTSW 10 52115997 missense probably benign 0.00
R4806:Ros1 UTSW 10 52096175 missense probably damaging 0.96
R4865:Ros1 UTSW 10 52172870 missense probably damaging 0.99
R4973:Ros1 UTSW 10 52154991 missense probably damaging 0.98
R5022:Ros1 UTSW 10 52124075 missense possibly damaging 0.46
R5033:Ros1 UTSW 10 52128416 critical splice donor site probably null
R5082:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5083:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5130:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5269:Ros1 UTSW 10 52051008 missense probably damaging 1.00
R5399:Ros1 UTSW 10 52090944 critical splice donor site probably null
R5414:Ros1 UTSW 10 52155093 missense probably damaging 1.00
R5659:Ros1 UTSW 10 52143386 missense possibly damaging 0.92
R5742:Ros1 UTSW 10 52142138 critical splice donor site probably null
R5780:Ros1 UTSW 10 52194857 missense probably damaging 1.00
R5805:Ros1 UTSW 10 52123289 missense probably damaging 1.00
R5843:Ros1 UTSW 10 52166197 missense possibly damaging 0.92
R5881:Ros1 UTSW 10 52181798 missense probably benign 0.26
R6027:Ros1 UTSW 10 52163968 missense possibly damaging 0.82
R6035:Ros1 UTSW 10 52077971 missense probably benign
R6035:Ros1 UTSW 10 52077971 missense probably benign
R6052:Ros1 UTSW 10 52163903 missense probably benign 0.39
R6175:Ros1 UTSW 10 52101785 missense probably benign 0.02
R6315:Ros1 UTSW 10 52118210 missense probably benign
R6342:Ros1 UTSW 10 52155255 missense probably damaging 1.00
R6470:Ros1 UTSW 10 52166044 critical splice donor site probably null
R6527:Ros1 UTSW 10 52143377 missense possibly damaging 0.66
R6568:Ros1 UTSW 10 52162812 missense probably damaging 1.00
R6573:Ros1 UTSW 10 52155010 missense possibly damaging 0.84
R6653:Ros1 UTSW 10 52142203 missense probably damaging 1.00
R6959:Ros1 UTSW 10 52163994 missense probably damaging 0.99
R7011:Ros1 UTSW 10 52180176 missense probably damaging 1.00
R7111:Ros1 UTSW 10 52181810 missense probably benign 0.02
R7243:Ros1 UTSW 10 52123381 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCCAAGCCTGAGTCTATATCC -3'
(R):5'- ACGGCATCTACAGAGTCAATCTCCC -3'

Sequencing Primer
(F):5'- AGATAAGTGCTCACTGGCTC -3'
(R):5'- agtcaatctccctttgccatc -3'
Posted On2013-05-23