Mutagenetix > Incidental Mutation

Incidental Mutation 'R5336:Col5a3'

423526

Institutional Source

Beutler Lab

Gene Symbol

Col5a3

Ensembl Gene

ENSMUSG00000004098

Gene Name

collagen, type V, alpha 3

Synonyms

Pro-alpha3(V)

MMRRC Submission

042844-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.398) question?

Stock #

R5336 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20681353-20726363 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20710597 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 551 (F551I)

Ref Sequence

ENSEMBL: ENSMUSP00000004201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004201]

AlphaFold

Q9JLI2

Predicted Effect

unknown
Transcript: ENSMUST00000004201
AA Change: F551I

SMART Domains

Protein: ENSMUSP00000004201
Gene: ENSMUSG00000004098
AA Change: F551I

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
TSPN	32	211	7.08e-28	SMART
LamG	89	210	2.13e-2	SMART
low complexity region	247	267	N/A	INTRINSIC
low complexity region	295	314	N/A	INTRINSIC
low complexity region	341	347	N/A	INTRINSIC
low complexity region	369	381	N/A	INTRINSIC
low complexity region	391	434	N/A	INTRINSIC
low complexity region	461	474	N/A	INTRINSIC
Pfam:Collagen	475	538	5.5e-10	PFAM
low complexity region	597	616	N/A	INTRINSIC
low complexity region	628	694	N/A	INTRINSIC
internal_repeat_3	703	737	7.13e-16	PROSPERO
low complexity region	742	821	N/A	INTRINSIC
low complexity region	823	844	N/A	INTRINSIC
low complexity region	859	889	N/A	INTRINSIC
internal_repeat_2	892	1081	5.05e-17	PROSPERO
internal_repeat_1	996	1133	7.47e-22	PROSPERO
internal_repeat_3	1105	1139	7.13e-16	PROSPERO
low complexity region	1140	1165	N/A	INTRINSIC
low complexity region	1168	1255	N/A	INTRINSIC
low complexity region	1258	1282	N/A	INTRINSIC
low complexity region	1285	1306	N/A	INTRINSIC
low complexity region	1311	1418	N/A	INTRINSIC
Pfam:Collagen	1429	1491	9.5e-10	PFAM
COLFI	1508	1738	7.98e-92	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145974

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. Mutations in this gene are thought to be responsible for the symptoms of a subset of patients with Ehlers-Danlos syndrome type III. Messages of several sizes can be detected in northern blots but sequence information cannot confirm the identity of the shorter messages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show decreased pancreatic beta cell mass, hyperglycemia, hypoinsulinemia, impaired glucose tolerance, insulin resistance and impaired glucose uptake. Homozygous females show decreased susceptibility to diet-induced obesity and a thin hypodermal fat layer. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330159F19Rik	A	T	10: 29,100,495 (GRCm39)	E289D	probably damaging	Het
Acyp1	A	T	12: 85,326,785 (GRCm39)	F80I	probably damaging	Het
Anapc5	T	C	5: 122,945,400 (GRCm39)	N226S	probably damaging	Het
Ankhd1	T	A	18: 36,779,769 (GRCm39)	S1704T	probably damaging	Het
Btnl5-ps	T	C	17: 34,711,371 (GRCm39)		noncoding transcript	Het
Cacna1h	T	C	17: 25,611,205 (GRCm39)	H531R	probably damaging	Het
Chpf	C	A	1: 75,452,351 (GRCm39)	A368S	possibly damaging	Het
Cntn4	T	C	6: 106,639,595 (GRCm39)	V575A	possibly damaging	Het
Ctnnd1	C	T	2: 84,447,133 (GRCm39)	V371M	probably damaging	Het
Dcxr	A	G	11: 120,618,002 (GRCm39)		probably null	Het
Ddost	T	C	4: 138,036,741 (GRCm39)	Y147H	possibly damaging	Het
Eif2ak2	A	G	17: 79,181,472 (GRCm39)	F92L	probably benign	Het
Gad1-ps	G	A	10: 99,281,009 (GRCm39)		noncoding transcript	Het
H2-T23	T	A	17: 36,342,550 (GRCm39)	N196I	possibly damaging	Het
Ighv9-2	A	C	12: 114,072,905 (GRCm39)	F23V	probably benign	Het
Igsf10	T	C	3: 59,227,553 (GRCm39)	E2040G	probably damaging	Het
Mtpn	C	T	6: 35,489,225 (GRCm39)	D100N	probably benign	Het
Myh4	A	G	11: 67,150,017 (GRCm39)		probably null	Het
Nlrp2	T	C	7: 5,331,118 (GRCm39)	D426G	probably benign	Het
Or1a1	T	C	11: 74,086,859 (GRCm39)	F177L	probably damaging	Het
Otof	T	C	5: 30,534,064 (GRCm39)	D1415G	probably benign	Het
Ppig	T	C	2: 69,580,568 (GRCm39)	S701P	unknown	Het
Ptprf	A	G	4: 118,092,831 (GRCm39)	I528T	probably damaging	Het
Scara3	A	G	14: 66,168,487 (GRCm39)	Y377H	probably damaging	Het
Slf1	A	T	13: 77,254,129 (GRCm39)	*176R	probably null	Het
Sntb1	C	G	15: 55,506,191 (GRCm39)	G461R	probably damaging	Het
Tarm1	T	C	7: 3,546,084 (GRCm39)	Y61C	probably damaging	Het
Tle4	A	G	19: 14,432,103 (GRCm39)		probably null	Het
Tlr1	A	T	5: 65,083,145 (GRCm39)	N477K	probably damaging	Het
Tns2	C	T	15: 102,019,664 (GRCm39)	T518M	probably damaging	Het
Trim50	C	T	5: 135,396,330 (GRCm39)	T426M	probably damaging	Het
Vmn2r85	T	C	10: 130,258,574 (GRCm39)	I494V	possibly damaging	Het
Wdr17	T	A	8: 55,085,353 (GRCm39)	I1257F	probably damaging	Het
Zfp874a	T	C	13: 67,590,799 (GRCm39)	H295R	probably damaging	Het

Other mutations in Col5a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00834:Col5a3	APN	9	20,697,685 (GRCm39)	nonsense	probably null
IGL01548:Col5a3	APN	9	20,714,296 (GRCm39)	splice site	probably benign
IGL02164:Col5a3	APN	9	20,703,939 (GRCm39)	critical splice donor site	probably null
IGL02297:Col5a3	APN	9	20,683,450 (GRCm39)	missense	unknown
IGL02333:Col5a3	APN	9	20,710,602 (GRCm39)	missense	unknown
IGL02349:Col5a3	APN	9	20,683,657 (GRCm39)	missense	unknown
IGL02390:Col5a3	APN	9	20,688,292 (GRCm39)	missense	unknown
IGL02685:Col5a3	APN	9	20,683,501 (GRCm39)	missense	unknown
IGL02941:Col5a3	APN	9	20,715,962 (GRCm39)	missense	unknown
IGL03001:Col5a3	APN	9	20,719,040 (GRCm39)	missense	unknown
IGL03061:Col5a3	APN	9	20,708,868 (GRCm39)	critical splice donor site	probably null
IGL03102:Col5a3	APN	9	20,715,931 (GRCm39)	critical splice donor site	probably null
IGL03308:Col5a3	APN	9	20,719,675 (GRCm39)	missense	unknown
IGL03372:Col5a3	APN	9	20,686,624 (GRCm39)	missense	unknown
Guppy	UTSW	9	20,690,329 (GRCm39)	missense	probably damaging	1.00
minifish	UTSW	9	20,696,882 (GRCm39)	missense	probably damaging	0.99
R0002:Col5a3	UTSW	9	20,721,152 (GRCm39)	critical splice acceptor site	probably null
R0012:Col5a3	UTSW	9	20,688,404 (GRCm39)	splice site	probably benign
R0316:Col5a3	UTSW	9	20,686,621 (GRCm39)	missense	unknown
R0357:Col5a3	UTSW	9	20,719,064 (GRCm39)	splice site	probably benign
R0360:Col5a3	UTSW	9	20,683,762 (GRCm39)	missense	unknown
R0483:Col5a3	UTSW	9	20,693,777 (GRCm39)	splice site	probably null
R0485:Col5a3	UTSW	9	20,694,004 (GRCm39)	missense	probably damaging	0.99
R0627:Col5a3	UTSW	9	20,686,781 (GRCm39)	missense	unknown
R1035:Col5a3	UTSW	9	20,704,795 (GRCm39)	splice site	probably benign
R1051:Col5a3	UTSW	9	20,686,531 (GRCm39)	missense	unknown
R1295:Col5a3	UTSW	9	20,719,714 (GRCm39)	missense	unknown
R1438:Col5a3	UTSW	9	20,691,253 (GRCm39)	missense	probably damaging	0.99
R1622:Col5a3	UTSW	9	20,683,516 (GRCm39)	missense	unknown
R1668:Col5a3	UTSW	9	20,682,392 (GRCm39)	missense	unknown
R1680:Col5a3	UTSW	9	20,695,964 (GRCm39)	critical splice donor site	probably null
R2112:Col5a3	UTSW	9	20,721,073 (GRCm39)	missense	unknown
R2149:Col5a3	UTSW	9	20,682,566 (GRCm39)	missense	unknown
R2159:Col5a3	UTSW	9	20,682,606 (GRCm39)	missense	unknown
R2939:Col5a3	UTSW	9	20,706,954 (GRCm39)	missense	unknown
R3236:Col5a3	UTSW	9	20,718,949 (GRCm39)	missense	unknown
R3845:Col5a3	UTSW	9	20,719,673 (GRCm39)	missense	unknown
R4598:Col5a3	UTSW	9	20,685,855 (GRCm39)	critical splice donor site	probably null
R4599:Col5a3	UTSW	9	20,685,855 (GRCm39)	critical splice donor site	probably null
R4611:Col5a3	UTSW	9	20,726,192 (GRCm39)	unclassified	probably benign
R4713:Col5a3	UTSW	9	20,704,870 (GRCm39)	missense	unknown
R4723:Col5a3	UTSW	9	20,720,887 (GRCm39)	missense	unknown
R5209:Col5a3	UTSW	9	20,689,939 (GRCm39)	intron	probably benign
R5378:Col5a3	UTSW	9	20,708,872 (GRCm39)	missense	unknown
R5614:Col5a3	UTSW	9	20,694,772 (GRCm39)	splice site	probably benign
R5775:Col5a3	UTSW	9	20,712,368 (GRCm39)	missense	unknown
R5895:Col5a3	UTSW	9	20,683,738 (GRCm39)	missense	unknown
R6048:Col5a3	UTSW	9	20,718,915 (GRCm39)	missense	unknown
R6265:Col5a3	UTSW	9	20,705,060 (GRCm39)	missense	unknown
R6372:Col5a3	UTSW	9	20,696,882 (GRCm39)	missense	probably damaging	0.99
R6520:Col5a3	UTSW	9	20,685,348 (GRCm39)	missense	unknown
R6558:Col5a3	UTSW	9	20,690,329 (GRCm39)	missense	probably damaging	1.00
R6608:Col5a3	UTSW	9	20,685,315 (GRCm39)	missense	unknown
R6679:Col5a3	UTSW	9	20,690,329 (GRCm39)	missense	probably damaging	1.00
R6680:Col5a3	UTSW	9	20,690,329 (GRCm39)	missense	probably damaging	1.00
R6696:Col5a3	UTSW	9	20,690,329 (GRCm39)	missense	probably damaging	1.00
R6698:Col5a3	UTSW	9	20,690,329 (GRCm39)	missense	probably damaging	1.00
R6700:Col5a3	UTSW	9	20,690,329 (GRCm39)	missense	probably damaging	1.00
R6708:Col5a3	UTSW	9	20,686,331 (GRCm39)	missense	unknown
R6712:Col5a3	UTSW	9	20,690,329 (GRCm39)	missense	probably damaging	1.00
R6714:Col5a3	UTSW	9	20,690,329 (GRCm39)	missense	probably damaging	1.00
R6828:Col5a3	UTSW	9	20,709,748 (GRCm39)	missense	unknown
R7343:Col5a3	UTSW	9	20,705,242 (GRCm39)	critical splice donor site	probably null
R7431:Col5a3	UTSW	9	20,682,131 (GRCm39)	makesense	probably null
R7500:Col5a3	UTSW	9	20,711,585 (GRCm39)	missense	unknown
R7592:Col5a3	UTSW	9	20,708,689 (GRCm39)	missense	unknown
R7671:Col5a3	UTSW	9	20,686,382 (GRCm39)	critical splice acceptor site	probably null
R7957:Col5a3	UTSW	9	20,685,347 (GRCm39)	missense	unknown
R8510:Col5a3	UTSW	9	20,705,028 (GRCm39)	missense	unknown
R8979:Col5a3	UTSW	9	20,686,597 (GRCm39)	missense	unknown
R9050:Col5a3	UTSW	9	20,697,691 (GRCm39)	missense	probably damaging	1.00
R9052:Col5a3	UTSW	9	20,710,733 (GRCm39)	missense	unknown
R9072:Col5a3	UTSW	9	20,682,453 (GRCm39)	missense	unknown
R9341:Col5a3	UTSW	9	20,704,909 (GRCm39)	missense	unknown
R9343:Col5a3	UTSW	9	20,704,909 (GRCm39)	missense	unknown
R9529:Col5a3	UTSW	9	20,685,308 (GRCm39)	critical splice donor site	probably null
R9562:Col5a3	UTSW	9	20,714,429 (GRCm39)	missense	unknown
R9781:Col5a3	UTSW	9	20,721,272 (GRCm39)	missense	unknown
Z1177:Col5a3	UTSW	9	20,686,630 (GRCm39)	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCCAAAGTCACCCTAGTGCAG -3'
(R):5'- TTCATTTTCTTCATAGGGCCGAG -3'

Sequencing Primer
(F):5'- TAAATTAGCATATGCAGGAGCCACTC -3'
(R):5'- TTCATAGGGCCGAGCTGGAG -3'

Posted On

2016-08-04