Incidental Mutation 'R5337:Uspl1'
ID423563
Institutional Source Beutler Lab
Gene Symbol Uspl1
Ensembl Gene ENSMUSG00000041264
Gene Nameubiquitin specific peptidase like 1
SynonymsE430026A01Rik
MMRRC Submission 042917-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R5337 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location149184350-149215434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 149214746 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 720 (S720P)
Ref Sequence ENSEMBL: ENSMUSP00000113894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050472] [ENSMUST00000100410] [ENSMUST00000117878] [ENSMUST00000119685] [ENSMUST00000121416] [ENSMUST00000122160] [ENSMUST00000126168]
Predicted Effect probably damaging
Transcript: ENSMUST00000050472
AA Change: S919P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050172
Gene: ENSMUSG00000041264
AA Change: S919P

DomainStartEndE-ValueType
low complexity region 174 192 N/A INTRINSIC
Pfam:Peptidase_C98 213 486 7e-139 PFAM
Pfam:DUF4650 557 1087 1.9e-213 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100410
SMART Domains Protein: ENSMUSP00000097978
Gene: ENSMUSG00000041264

DomainStartEndE-ValueType
low complexity region 174 192 N/A INTRINSIC
Pfam:Peptidase_C98 213 486 1.4e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117878
SMART Domains Protein: ENSMUSP00000113176
Gene: ENSMUSG00000041264

DomainStartEndE-ValueType
Pfam:Peptidase_C98 14 287 5.6e-140 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119685
AA Change: S905P

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114104
Gene: ENSMUSG00000041264
AA Change: S905P

DomainStartEndE-ValueType
low complexity region 160 178 N/A INTRINSIC
Pfam:Peptidase_C98 199 472 6.9e-139 PFAM
Pfam:DUF4650 543 1073 1.8e-213 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121416
AA Change: S720P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113894
Gene: ENSMUSG00000041264
AA Change: S720P

DomainStartEndE-ValueType
Pfam:Peptidase_C98 14 287 8.5e-139 PFAM
Pfam:DUF4650 358 888 1.5e-213 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122160
AA Change: S919P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113247
Gene: ENSMUSG00000041264
AA Change: S919P

DomainStartEndE-ValueType
low complexity region 174 192 N/A INTRINSIC
Pfam:Peptidase_C98 214 486 2.5e-125 PFAM
Pfam:DUF4650 558 1087 1e-205 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150921
Meta Mutation Damage Score 0.0248 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik C A 9: 50,765,749 C14F probably benign Het
2610507B11Rik T A 11: 78,265,208 I182N possibly damaging Het
Abhd15 T A 11: 77,518,839 probably null Het
Akap8l A G 17: 32,336,394 M237T possibly damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Api5 G T 2: 94,425,688 A218E possibly damaging Het
BC067074 T A 13: 113,318,765 H448Q probably damaging Het
Cftr A G 6: 18,319,059 D1336G probably damaging Het
Chd1l G A 3: 97,562,616 R865W probably damaging Het
Cmya5 T C 13: 93,083,273 K3223E probably benign Het
Cuzd1 A G 7: 131,316,074 Y266H probably damaging Het
Dnajc5b A T 3: 19,574,782 Y80F probably damaging Het
Dock6 A G 9: 21,829,548 S915P possibly damaging Het
Fam166b C T 4: 43,427,687 probably null Het
Fat4 T A 3: 38,891,627 D1556E probably damaging Het
Fat4 A G 3: 39,010,378 T4828A probably benign Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gja3 T G 14: 57,035,832 D361A probably benign Het
Gpr155 T C 2: 73,348,248 E704G probably benign Het
Greb1l A G 18: 10,509,143 E485G probably damaging Het
Grik1 CGG CGGG 16: 87,923,194 probably null Het
H6pd A G 4: 149,981,784 V715A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnip1 T G 11: 33,642,389 probably benign Het
Kif21b T C 1: 136,171,143 S1390P probably damaging Het
Lrrc61 G A 6: 48,568,374 V44M probably damaging Het
Map3k4 G T 17: 12,271,610 N311K probably damaging Het
Mgat5 T C 1: 127,459,921 F538S possibly damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Ndst1 A T 18: 60,690,007 L829Q probably damaging Het
Neto1 A T 18: 86,398,309 H47L probably benign Het
Olfr1333 T C 4: 118,829,666 Y258C probably benign Het
Olfr485 A T 7: 108,159,273 V200D probably benign Het
Olfr550 T C 7: 102,579,274 S260P probably damaging Het
Olfr807 A T 10: 129,754,534 C305* probably null Het
Olfr9 A G 10: 128,990,679 T256A probably benign Het
Pds5b T C 5: 150,793,597 F1120L probably benign Het
Phkb A G 8: 85,878,245 Y93C probably damaging Het
Pilra C T 5: 137,835,770 probably benign Het
Pmvk T C 3: 89,468,571 V146A probably benign Het
Proz T A 8: 13,066,854 D135E probably benign Het
Psg23 A T 7: 18,612,072 W233R probably benign Het
Rgl2 A T 17: 33,934,984 I455F probably damaging Het
Rhpn1 A G 15: 75,708,205 Q39R probably benign Het
Rims4 T G 2: 163,865,843 M100L probably benign Het
Sacs T A 14: 61,193,514 probably benign Het
Slfn4 T C 11: 83,189,229 F189L probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tmem127 T C 2: 127,256,145 Y129H probably damaging Het
Trim50 C T 5: 135,367,476 T426M probably damaging Het
Trpc3 A T 3: 36,638,370 probably benign Het
Tsga10ip A T 19: 5,394,335 S23T probably benign Het
Zc3h18 A G 8: 122,386,902 D211G probably damaging Het
Zcchc6 G A 13: 59,791,852 T695I probably damaging Het
Zswim4 G A 8: 84,235,079 P55L probably damaging Het
Other mutations in Uspl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Uspl1 APN 5 149215214 missense possibly damaging 0.95
IGL00571:Uspl1 APN 5 149188360 missense probably damaging 0.99
IGL01134:Uspl1 APN 5 149204293 missense probably damaging 1.00
IGL02222:Uspl1 APN 5 149194044 missense probably benign 0.25
IGL02383:Uspl1 APN 5 149213402 missense probably damaging 0.98
IGL02538:Uspl1 APN 5 149188459 missense probably damaging 1.00
IGL02546:Uspl1 APN 5 149204304 missense possibly damaging 0.95
IGL02585:Uspl1 APN 5 149214062 nonsense probably null
IGL02971:Uspl1 APN 5 149188346 missense possibly damaging 0.84
R0020:Uspl1 UTSW 5 149209779 missense probably damaging 1.00
R0070:Uspl1 UTSW 5 149209705 missense probably damaging 1.00
R0142:Uspl1 UTSW 5 149188349 missense possibly damaging 0.68
R0433:Uspl1 UTSW 5 149214815 missense probably damaging 1.00
R0554:Uspl1 UTSW 5 149187834 missense probably damaging 1.00
R0612:Uspl1 UTSW 5 149214957 missense probably damaging 1.00
R1195:Uspl1 UTSW 5 149194321 missense probably benign 0.24
R1195:Uspl1 UTSW 5 149194321 missense probably benign 0.24
R1195:Uspl1 UTSW 5 149194321 missense probably benign 0.24
R1465:Uspl1 UTSW 5 149214032 missense probably benign 0.12
R1465:Uspl1 UTSW 5 149214032 missense probably benign 0.12
R1623:Uspl1 UTSW 5 149215199 missense probably damaging 1.00
R1737:Uspl1 UTSW 5 149201858 missense probably damaging 1.00
R1793:Uspl1 UTSW 5 149213436 missense probably damaging 1.00
R1823:Uspl1 UTSW 5 149214414 missense probably benign 0.25
R2088:Uspl1 UTSW 5 149209750 missense probably damaging 1.00
R2099:Uspl1 UTSW 5 149214758 missense probably damaging 1.00
R2497:Uspl1 UTSW 5 149187854 missense probably damaging 0.98
R2944:Uspl1 UTSW 5 149201796 missense probably damaging 1.00
R3437:Uspl1 UTSW 5 149214697 utr 3 prime probably benign
R4132:Uspl1 UTSW 5 149204349 missense probably damaging 0.99
R4458:Uspl1 UTSW 5 149214152 missense possibly damaging 0.82
R4537:Uspl1 UTSW 5 149187778 missense possibly damaging 0.66
R4623:Uspl1 UTSW 5 149214595 missense probably damaging 0.99
R4633:Uspl1 UTSW 5 149214392 missense probably damaging 1.00
R4737:Uspl1 UTSW 5 149194339 missense possibly damaging 0.86
R4743:Uspl1 UTSW 5 149209756 missense probably damaging 1.00
R5200:Uspl1 UTSW 5 149214113 missense probably benign 0.02
R5222:Uspl1 UTSW 5 149214101 missense possibly damaging 0.77
R5496:Uspl1 UTSW 5 149209779 missense probably damaging 1.00
R5654:Uspl1 UTSW 5 149209711 missense probably damaging 1.00
R5845:Uspl1 UTSW 5 149193960 missense probably benign 0.01
R6266:Uspl1 UTSW 5 149204366 missense probably damaging 1.00
R6331:Uspl1 UTSW 5 149214287 missense probably benign 0.40
R6338:Uspl1 UTSW 5 149215034 missense probably benign 0.03
R6774:Uspl1 UTSW 5 149214094 missense probably benign 0.00
R6855:Uspl1 UTSW 5 149187845 missense probably damaging 1.00
R7131:Uspl1 UTSW 5 149193935 missense probably benign 0.00
R7152:Uspl1 UTSW 5 149187778 missense possibly damaging 0.66
R7446:Uspl1 UTSW 5 149204272 nonsense probably null
X0019:Uspl1 UTSW 5 149214267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAAAGCGCCATCTCTCC -3'
(R):5'- TTCTGAGGGCTCTGACATGG -3'

Sequencing Primer
(F):5'- ATCTCTCCAGCAAGCCGTG -3'
(R):5'- TCTGACATGGCTGTAGGCGAC -3'
Posted On2016-08-04