Incidental Mutation 'R5337:1110032A03Rik'
List |< first << previous [record 6 of 18487] next >> last >|
ID423578
Institutional Source Beutler Lab
Gene Symbol 1110032A03Rik
Ensembl Gene ENSMUSG00000037971
Gene NameRIKEN cDNA 1110032A03 gene
Synonyms
MMRRC Submission 042917-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5337 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location50762828-50775520 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 50765749 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 14 (C14F)
Ref Sequence ENSEMBL: ENSMUSP00000046890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042391] [ENSMUST00000042468] [ENSMUST00000042576] [ENSMUST00000176145] [ENSMUST00000176238] [ENSMUST00000176335] [ENSMUST00000177384] [ENSMUST00000177546]
Predicted Effect probably benign
Transcript: ENSMUST00000042391
SMART Domains Protein: ENSMUSP00000037082
Gene: ENSMUSG00000037845

DomainStartEndE-ValueType
Pfam:DUF2431 7 176 1.4e-44 PFAM
low complexity region 258 269 N/A INTRINSIC
SCOP:d1jjca_ 487 516 6e-4 SMART
FDX-ACB 528 622 5.88e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042468
SMART Domains Protein: ENSMUSP00000041803
Gene: ENSMUSG00000037971

DomainStartEndE-ValueType
Pfam:DUF1143 1 149 7.7e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042576
AA Change: C14F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046890
Gene: ENSMUSG00000037971
AA Change: C14F

DomainStartEndE-ValueType
Pfam:DUF1143 15 164 1.8e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176145
SMART Domains Protein: ENSMUSP00000135796
Gene: ENSMUSG00000037845

DomainStartEndE-ValueType
Pfam:DUF2431 7 115 4.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176160
Predicted Effect probably benign
Transcript: ENSMUST00000176238
SMART Domains Protein: ENSMUSP00000135679
Gene: ENSMUSG00000037971

DomainStartEndE-ValueType
Pfam:DUF1143 1 70 4.2e-47 PFAM
Pfam:DUF1143 68 126 5.3e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176335
SMART Domains Protein: ENSMUSP00000135658
Gene: ENSMUSG00000037845

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
SCOP:d1jjca_ 285 314 3e-4 SMART
FDX-ACB 326 420 5.88e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177142
Predicted Effect probably benign
Transcript: ENSMUST00000177384
Predicted Effect probably benign
Transcript: ENSMUST00000177546
SMART Domains Protein: ENSMUSP00000134870
Gene: ENSMUSG00000037971

DomainStartEndE-ValueType
Pfam:DUF1143 13 72 3.3e-39 PFAM
Meta Mutation Damage Score 0.1572 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,265,208 I182N possibly damaging Het
Abhd15 T A 11: 77,518,839 probably null Het
Akap8l A G 17: 32,336,394 M237T possibly damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Api5 G T 2: 94,425,688 A218E possibly damaging Het
BC067074 T A 13: 113,318,765 H448Q probably damaging Het
Cftr A G 6: 18,319,059 D1336G probably damaging Het
Chd1l G A 3: 97,562,616 R865W probably damaging Het
Cmya5 T C 13: 93,083,273 K3223E probably benign Het
Cuzd1 A G 7: 131,316,074 Y266H probably damaging Het
Dnajc5b A T 3: 19,574,782 Y80F probably damaging Het
Dock6 A G 9: 21,829,548 S915P possibly damaging Het
Fam166b C T 4: 43,427,687 probably null Het
Fat4 T A 3: 38,891,627 D1556E probably damaging Het
Fat4 A G 3: 39,010,378 T4828A probably benign Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gja3 T G 14: 57,035,832 D361A probably benign Het
Gpr155 T C 2: 73,348,248 E704G probably benign Het
Greb1l A G 18: 10,509,143 E485G probably damaging Het
Grik1 CGG CGGG 16: 87,923,194 probably null Het
H6pd A G 4: 149,981,784 V715A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnip1 T G 11: 33,642,389 probably benign Het
Kif21b T C 1: 136,171,143 S1390P probably damaging Het
Lrrc61 G A 6: 48,568,374 V44M probably damaging Het
Map3k4 G T 17: 12,271,610 N311K probably damaging Het
Mgat5 T C 1: 127,459,921 F538S possibly damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Ndst1 A T 18: 60,690,007 L829Q probably damaging Het
Neto1 A T 18: 86,398,309 H47L probably benign Het
Olfr1333 T C 4: 118,829,666 Y259C probably benign Het
Olfr485 A T 7: 108,159,273 V200D probably benign Het
Olfr550 T C 7: 102,579,274 S260P probably damaging Het
Olfr807 A T 10: 129,754,534 C305* probably null Het
Olfr9 A G 10: 128,990,679 T256A probably benign Het
Pds5b T C 5: 150,793,597 F1120L probably benign Het
Phkb A G 8: 85,878,245 Y93C probably damaging Het
Pilra C T 5: 137,835,770 probably benign Het
Pmvk T C 3: 89,468,571 V146A probably benign Het
Proz T A 8: 13,066,854 D135E probably benign Het
Psg23 A T 7: 18,612,072 W233R probably benign Het
Rgl2 A T 17: 33,934,984 I455F probably damaging Het
Rhpn1 A G 15: 75,708,205 Q39R probably benign Het
Rims4 T G 2: 163,865,843 M100L probably benign Het
Sacs T A 14: 61,193,514 probably benign Het
Slfn4 T C 11: 83,189,229 F189L probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tmem127 T C 2: 127,256,145 Y129H probably damaging Het
Trim50 C T 5: 135,367,476 T426M probably damaging Het
Trpc3 A T 3: 36,638,370 probably benign Het
Tsga10ip A T 19: 5,394,335 S23T probably benign Het
Uspl1 T C 5: 149,214,746 S720P probably damaging Het
Zc3h18 A G 8: 122,386,902 D211G probably damaging Het
Zcchc6 G A 13: 59,791,852 T695I probably damaging Het
Zswim4 G A 8: 84,235,079 P55L probably damaging Het
Other mutations in 1110032A03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1535:1110032A03Rik UTSW 9 50764007 missense probably damaging 0.97
R2145:1110032A03Rik UTSW 9 50764874 missense probably damaging 1.00
R3748:1110032A03Rik UTSW 9 50765750 missense probably benign 0.00
R5258:1110032A03Rik UTSW 9 50764333 intron probably benign
R5408:1110032A03Rik UTSW 9 50764757 missense probably damaging 1.00
R5672:1110032A03Rik UTSW 9 50763927 missense probably benign 0.03
R6242:1110032A03Rik UTSW 9 50763915 missense probably benign 0.00
R6326:1110032A03Rik UTSW 9 50764757 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATCAGTAGTTACCCTCCCAATG -3'
(R):5'- GATGATGTGAGGGCAGTCAC -3'

Sequencing Primer
(F):5'- TCAGTAGTTACCCTCCCAATGAATAG -3'
(R):5'- TGTGAGGGCAGTCACCTACAATC -3'
Posted On2016-08-04