Incidental Mutation 'R0487:Stxbp4'
ID42359
Institutional Source Beutler Lab
Gene Symbol Stxbp4
Ensembl Gene ENSMUSG00000020546
Gene Namesyntaxin binding protein 4
SynonymsSynip, 6030470M02Rik
MMRRC Submission 038686-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R0487 (G1)
Quality Score175
Status Not validated
Chromosome11
Chromosomal Location90476492-90638084 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90592360 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 280 (H280R)
Ref Sequence ENSEMBL: ENSMUSP00000116191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020858] [ENSMUST00000143203]
Predicted Effect probably benign
Transcript: ENSMUST00000020858
AA Change: H280R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000020858
Gene: ENSMUSG00000020546
AA Change: H280R

DomainStartEndE-ValueType
PDZ 29 109 6.13e-10 SMART
low complexity region 131 154 N/A INTRINSIC
coiled coil region 298 409 N/A INTRINSIC
low complexity region 504 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143203
AA Change: H280R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000116191
Gene: ENSMUSG00000020546
AA Change: H280R

DomainStartEndE-ValueType
PDZ 29 109 6.13e-10 SMART
low complexity region 131 154 N/A INTRINSIC
coiled coil region 298 409 N/A INTRINSIC
WW 501 533 1.11e-10 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,331,687 M3190L probably benign Het
Adgrv1 A T 13: 81,489,035 L3429H probably damaging Het
Ahnak A G 19: 9,007,151 N1933S probably benign Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
AI314180 A G 4: 58,819,155 V1265A probably damaging Het
Amacr A G 15: 10,984,749 D151G probably benign Het
Ano9 A T 7: 141,107,849 H255Q possibly damaging Het
Asphd2 A T 5: 112,391,635 Y111N probably damaging Het
Cage1 T A 13: 38,025,358 K214N probably benign Het
Cdkn2c A G 4: 109,661,409 L116P probably damaging Het
Cltc C T 11: 86,733,664 R148H probably damaging Het
Cmbl A G 15: 31,582,030 N58D probably damaging Het
Cpa6 T C 1: 10,409,262 T249A possibly damaging Het
Cpsf1 T A 15: 76,597,002 N1218I probably damaging Het
Csf2rb T C 15: 78,348,331 S613P probably benign Het
Ctnnd1 A G 2: 84,609,067 S761P probably damaging Het
Cxcr6 A C 9: 123,810,398 I155L probably benign Het
Fam216a A G 5: 122,370,513 probably null Het
Fgf10 T A 13: 118,781,611 probably null Het
Fgf17 T C 14: 70,638,556 T79A probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm1527 G T 3: 28,926,679 V643L probably benign Het
Gm7534 A T 4: 134,202,778 L72Q probably damaging Het
Hmcn2 A T 2: 31,386,677 Q1556L possibly damaging Het
Hrasls G A 16: 29,220,579 probably null Het
Hspa4l C T 3: 40,784,326 T616I possibly damaging Het
Irgm1 T C 11: 48,866,327 D219G probably damaging Het
Jcad A G 18: 4,673,243 D335G probably damaging Het
Kcnh4 A G 11: 100,750,258 F455S probably damaging Het
Khdrbs3 T C 15: 69,017,361 Y120H probably damaging Het
Kndc1 A T 7: 139,914,023 T507S probably null Het
Lepr G T 4: 101,768,093 E482* probably null Het
Lrmp A G 6: 145,165,260 S264G probably benign Het
Mcemp1 T A 8: 3,667,507 M146K probably benign Het
Mllt10 A G 2: 18,207,137 T411A probably damaging Het
Myh8 A T 11: 67,302,011 I1543L probably benign Het
Myo1f T C 17: 33,578,284 S147P probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Olfr1106 C T 2: 87,048,493 V248I probably damaging Het
Plch2 G A 4: 155,009,012 R57C probably damaging Het
Rbm20 G A 19: 53,851,195 G872R probably damaging Het
Retsat A T 6: 72,606,431 I373F probably damaging Het
Rnf145 T C 11: 44,555,229 F297L probably benign Het
Ros1 A T 10: 52,155,108 M479K possibly damaging Het
Rubcnl T A 14: 75,036,081 N244K probably benign Het
Samhd1 A G 2: 157,110,615 F406L probably damaging Het
Sdsl A T 5: 120,459,468 V258D probably damaging Het
Sec24c C G 14: 20,683,399 P166A probably benign Het
Sele C A 1: 164,053,615 Y461* probably null Het
Slc22a1 G T 17: 12,662,600 S334* probably null Het
Spem1 T G 11: 69,821,865 probably null Het
Stat3 T C 11: 100,903,643 E280G probably damaging Het
Tas2r129 G A 6: 132,951,943 C281Y probably benign Het
Tas2r129 T G 6: 132,951,944 C281W probably benign Het
Tcp11 T A 17: 28,079,923 probably null Het
Tnrc6b G A 15: 80,880,675 V793M probably benign Het
Vmn2r59 A C 7: 42,047,104 Y71* probably null Het
Wdr35 T C 12: 9,012,743 probably null Het
Zan A G 5: 137,413,358 probably null Het
Zap70 G T 1: 36,779,284 V351L probably damaging Het
Zfp609 G T 9: 65,702,634 Q1016K unknown Het
Zfp641 C A 15: 98,289,179 V188L probably benign Het
Other mutations in Stxbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Stxbp4 APN 11 90535512 missense probably benign 0.00
IGL01312:Stxbp4 APN 11 90621649 splice site probably benign
IGL01313:Stxbp4 APN 11 90621649 splice site probably benign
IGL01314:Stxbp4 APN 11 90621649 splice site probably benign
IGL01316:Stxbp4 APN 11 90621649 splice site probably benign
IGL01377:Stxbp4 APN 11 90621649 splice site probably benign
IGL01380:Stxbp4 APN 11 90621649 splice site probably benign
IGL01385:Stxbp4 APN 11 90540248 missense possibly damaging 0.95
IGL01408:Stxbp4 APN 11 90621649 splice site probably benign
IGL02573:Stxbp4 APN 11 90540269 missense probably damaging 0.99
IGL02707:Stxbp4 APN 11 90537933 missense probably benign 0.00
IGL02809:Stxbp4 APN 11 90600184 critical splice donor site probably null
IGL02900:Stxbp4 APN 11 90607035 missense probably benign 0.03
IGL03177:Stxbp4 APN 11 90571753 missense probably benign 0.01
IGL03397:Stxbp4 APN 11 90540234 missense probably damaging 1.00
IGL02799:Stxbp4 UTSW 11 90494600 critical splice donor site probably null
IGL03134:Stxbp4 UTSW 11 90607184 missense probably damaging 0.98
R0005:Stxbp4 UTSW 11 90548917 missense possibly damaging 0.78
R0930:Stxbp4 UTSW 11 90621700 start codon destroyed probably null 0.99
R1633:Stxbp4 UTSW 11 90540160 splice site probably benign
R3785:Stxbp4 UTSW 11 90535615 critical splice acceptor site probably null
R4359:Stxbp4 UTSW 11 90494644 nonsense probably null
R4591:Stxbp4 UTSW 11 90594780 missense probably benign 0.33
R4756:Stxbp4 UTSW 11 90607371 missense probably damaging 1.00
R5095:Stxbp4 UTSW 11 90548975 missense probably benign 0.00
R5870:Stxbp4 UTSW 11 90537956 missense possibly damaging 0.89
R6268:Stxbp4 UTSW 11 90540201 nonsense probably null
R6460:Stxbp4 UTSW 11 90606985 missense probably benign 0.35
R6479:Stxbp4 UTSW 11 90619187 missense probably damaging 0.99
R7139:Stxbp4 UTSW 11 90607009 nonsense probably null
V8831:Stxbp4 UTSW 11 90480671 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- GGAGTTCAATCCCTAGAACCCAGGTAA -3'
(R):5'- TGTGTGTCAGAGCTAACTGAAGTGAGA -3'

Sequencing Primer
(F):5'- tgggcagggaggaacag -3'
(R):5'- TACATCACACTCTGGTCAATACTG -3'
Posted On2013-05-23