Incidental Mutation 'R5338:Dclk3'
ID423638
Institutional Source Beutler Lab
Gene Symbol Dclk3
Ensembl Gene ENSMUSG00000032500
Gene Namedoublecortin-like kinase 3
SynonymsClick-I, -II related, Dcamkl3
Accession Numbers

Genbank: NM_172928; MGI: 3039580

Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R5338 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location111439081-111489118 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111469059 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 557 (V557A)
Ref Sequence ENSEMBL: ENSMUSP00000107510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111879]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111879
AA Change: V557A

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107510
Gene: ENSMUSG00000032500
AA Change: V557A

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
Pfam:DCX 115 177 2.9e-17 PFAM
low complexity region 200 218 N/A INTRINSIC
low complexity region 267 277 N/A INTRINSIC
low complexity region 479 496 N/A INTRINSIC
S_TKc 514 771 1.63e-110 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the protein kinase superfamily and the doublecortin family. Differently from the other two closely related family members (DCLK1 and DCLK2), the protein encoded by this gene contains only one N-terminal doublecortin domain and is unable to bind microtubules and to regulate microtubule polymerization. The protein contains a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmoduline-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. [provided by RefSeq, Sep 2010]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T A 9: 99,620,544 N252K probably damaging Het
Abhd16a A G 17: 35,094,302 E132G probably damaging Het
Adgrv1 G A 13: 81,529,046 R1889W possibly damaging Het
Aftph A T 11: 20,727,203 D135E probably benign Het
Arf1 A C 11: 59,213,215 F63V probably damaging Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
B3gnt7 T A 1: 86,305,644 F87Y probably damaging Het
Bcat1 A G 6: 145,007,627 Y345H possibly damaging Het
Birc3 G T 9: 7,857,359 T371K probably benign Het
Ccdc175 A T 12: 72,184,971 S5T probably damaging Het
Ccdc186 A T 19: 56,813,257 S143T possibly damaging Het
Cct6b A T 11: 82,762,189 M28K possibly damaging Het
Cers4 C A 8: 4,515,680 A42D probably damaging Het
Crmp1 G T 5: 37,279,674 V236L probably benign Het
Ctdspl2 T A 2: 121,981,312 N212K probably benign Het
Dnmt1 A T 9: 20,952,719 H23Q probably benign Het
Dpp8 G T 9: 65,063,924 E609* probably null Het
Dtx3 C A 10: 127,193,050 M106I probably benign Het
Ero1lb A C 13: 12,574,851 D45A probably damaging Het
Fcho2 T A 13: 98,730,891 D688V probably damaging Het
Fhod3 A T 18: 25,028,081 S557C probably damaging Het
Flnc T C 6: 29,444,064 S626P possibly damaging Het
Foxi3 G T 6: 70,960,618 G278V probably damaging Het
Gbp10 A G 5: 105,224,300 L198P probably damaging Het
Gcn1l1 A G 5: 115,583,403 T458A probably benign Het
Gigyf1 C T 5: 137,523,160 probably benign Het
Gtpbp2 A C 17: 46,167,834 T526P probably damaging Het
Gys2 A G 6: 142,454,513 L324S probably damaging Het
Hpn C A 7: 31,103,356 V119L probably benign Het
Ino80d C A 1: 63,058,939 V599L probably benign Het
Kcnh3 G T 15: 99,242,394 G1054* probably null Het
Maml1 A T 11: 50,266,951 D132E probably benign Het
Mastl A T 2: 23,133,491 S407T probably benign Het
Mettl1 T C 10: 127,043,085 W3R probably damaging Het
Mprip A G 11: 59,760,573 Y1701C probably damaging Het
Mylk3 T C 8: 85,342,721 N484D probably damaging Het
Nod2 G A 8: 88,672,785 probably null Het
Nrde2 A T 12: 100,130,778 F921Y probably damaging Het
Nup88 G T 11: 70,944,908 T575N probably damaging Het
Nxpe3 T C 16: 55,866,343 T101A possibly damaging Het
Olfr1214 C T 2: 88,987,465 V246I possibly damaging Het
Olfr458 A G 6: 42,460,974 M15T probably benign Het
Olfr672 A G 7: 104,996,307 L199S possibly damaging Het
Olfr951 A T 9: 39,394,075 I92F probably damaging Het
Olfr98 T A 17: 37,263,641 T8S probably benign Het
Pcnx3 A T 19: 5,672,596 L1356Q probably damaging Het
Pkd1 A T 17: 24,594,536 M4017L probably benign Het
Polg2 A G 11: 106,779,238 C69R possibly damaging Het
Prr5l T G 2: 101,717,107 S358R probably benign Het
Ptprg A G 14: 12,154,111 T611A probably benign Het
Ryk G T 9: 102,897,317 E417* probably null Het
Sbp T C 17: 23,942,422 probably benign Het
Sema4a T C 3: 88,451,497 T155A probably benign Het
Shank3 A G 15: 89,531,711 probably null Het
Slc35d2 A T 13: 64,097,682 M294K possibly damaging Het
Slc41a3 A T 6: 90,612,171 N88I possibly damaging Het
Slit3 A G 11: 35,622,148 T534A probably benign Het
Ssx2ip A G 3: 146,436,541 probably null Het
Stard13 T C 5: 151,059,598 K648R probably damaging Het
Tanc1 A T 2: 59,795,834 T512S probably damaging Het
Tbcc T C 17: 46,891,156 V156A probably benign Het
Terf1 T G 1: 15,831,563 I273R possibly damaging Het
Tesc A G 5: 118,059,458 Y179C probably damaging Het
Ttc3 T G 16: 94,384,041 V40G probably damaging Het
Tysnd1 T A 10: 61,696,249 F227I probably damaging Het
Vps53 T C 11: 76,081,208 E271G probably damaging Het
Wdfy4 C T 14: 33,090,866 R1650H probably damaging Het
Other mutations in Dclk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Dclk3 APN 9 111467843 nonsense probably null
IGL02125:Dclk3 APN 9 111469107 missense probably damaging 1.00
IGL02547:Dclk3 APN 9 111469023 missense probably damaging 1.00
IGL03393:Dclk3 APN 9 111488673 utr 3 prime probably benign
IGL02984:Dclk3 UTSW 9 111488575 missense probably damaging 1.00
R0109:Dclk3 UTSW 9 111467670 missense possibly damaging 0.93
R0109:Dclk3 UTSW 9 111467670 missense possibly damaging 0.93
R0238:Dclk3 UTSW 9 111482628 missense probably damaging 0.99
R0238:Dclk3 UTSW 9 111482628 missense probably damaging 0.99
R0432:Dclk3 UTSW 9 111484935 missense probably damaging 1.00
R0440:Dclk3 UTSW 9 111469163 missense probably damaging 1.00
R0530:Dclk3 UTSW 9 111482721 missense probably damaging 1.00
R1024:Dclk3 UTSW 9 111469070 missense possibly damaging 0.95
R1443:Dclk3 UTSW 9 111469020 missense probably benign 0.01
R1474:Dclk3 UTSW 9 111469236 missense probably benign 0.43
R1479:Dclk3 UTSW 9 111468546 missense probably benign
R1482:Dclk3 UTSW 9 111467820 missense possibly damaging 0.90
R1543:Dclk3 UTSW 9 111468054 missense probably benign 0.04
R1552:Dclk3 UTSW 9 111488579 missense probably damaging 1.00
R1559:Dclk3 UTSW 9 111469208 missense probably damaging 1.00
R2011:Dclk3 UTSW 9 111468354 missense probably benign 0.00
R2369:Dclk3 UTSW 9 111488542 missense probably benign 0.16
R4111:Dclk3 UTSW 9 111469080 missense probably damaging 0.99
R4510:Dclk3 UTSW 9 111467992 missense probably benign 0.01
R4511:Dclk3 UTSW 9 111467992 missense probably benign 0.01
R4592:Dclk3 UTSW 9 111467895 missense probably damaging 1.00
R4604:Dclk3 UTSW 9 111469185 missense probably damaging 1.00
R4857:Dclk3 UTSW 9 111468648 missense probably benign
R4932:Dclk3 UTSW 9 111468042 missense possibly damaging 0.56
R5045:Dclk3 UTSW 9 111467788 missense probably damaging 0.99
R5233:Dclk3 UTSW 9 111468681 missense probably benign
R5463:Dclk3 UTSW 9 111469260 missense probably benign 0.26
R6822:Dclk3 UTSW 9 111439337 missense probably benign 0.03
X0020:Dclk3 UTSW 9 111485075 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAGGGCATCATCTCAGC -3'
(R):5'- CCAGGAGGTTTTCTGGTTTCAC -3'

Sequencing Primer
(F):5'- CATCATCTCAGCGGATGTGGAG -3'
(R):5'- AGTCTGTGATCATAACTGCAGCC -3'
Posted On2016-08-04