Incidental Mutation 'R5338:Fcho2'
ID423655
Institutional Source Beutler Lab
Gene Symbol Fcho2
Ensembl Gene ENSMUSG00000041685
Gene NameFCH domain only 2
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5338 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location98723403-98815449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98730891 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 688 (D688V)
Ref Sequence ENSEMBL: ENSMUSP00000042959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040340] [ENSMUST00000099277]
Predicted Effect probably damaging
Transcript: ENSMUST00000040340
AA Change: D688V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042959
Gene: ENSMUSG00000041685
AA Change: D688V

DomainStartEndE-ValueType
FCH 8 94 1.74e-19 SMART
low complexity region 341 351 N/A INTRINSIC
low complexity region 433 456 N/A INTRINSIC
low complexity region 485 501 N/A INTRINSIC
low complexity region 503 520 N/A INTRINSIC
Pfam:muHD 542 808 2.5e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099277
SMART Domains Protein: ENSMUSP00000096883
Gene: ENSMUSG00000041685

DomainStartEndE-ValueType
FCH 8 94 1.74e-19 SMART
low complexity region 342 352 N/A INTRINSIC
low complexity region 434 457 N/A INTRINSIC
low complexity region 486 502 N/A INTRINSIC
low complexity region 504 521 N/A INTRINSIC
Pfam:muHD 543 803 4.7e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225945
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T A 9: 99,620,544 N252K probably damaging Het
Abhd16a A G 17: 35,094,302 E132G probably damaging Het
Adgrv1 G A 13: 81,529,046 R1889W possibly damaging Het
Aftph A T 11: 20,727,203 D135E probably benign Het
Arf1 A C 11: 59,213,215 F63V probably damaging Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
B3gnt7 T A 1: 86,305,644 F87Y probably damaging Het
Bcat1 A G 6: 145,007,627 Y345H possibly damaging Het
Birc3 G T 9: 7,857,359 T371K probably benign Het
Ccdc175 A T 12: 72,184,971 S5T probably damaging Het
Ccdc186 A T 19: 56,813,257 S143T possibly damaging Het
Cct6b A T 11: 82,762,189 M28K possibly damaging Het
Cers4 C A 8: 4,515,680 A42D probably damaging Het
Crmp1 G T 5: 37,279,674 V236L probably benign Het
Ctdspl2 T A 2: 121,981,312 N212K probably benign Het
Dclk3 T C 9: 111,469,059 V557A possibly damaging Het
Dnmt1 A T 9: 20,952,719 H23Q probably benign Het
Dpp8 G T 9: 65,063,924 E609* probably null Het
Dtx3 C A 10: 127,193,050 M106I probably benign Het
Ero1lb A C 13: 12,574,851 D45A probably damaging Het
Fhod3 A T 18: 25,028,081 S557C probably damaging Het
Flnc T C 6: 29,444,064 S626P possibly damaging Het
Foxi3 G T 6: 70,960,618 G278V probably damaging Het
Gbp10 A G 5: 105,224,300 L198P probably damaging Het
Gcn1l1 A G 5: 115,583,403 T458A probably benign Het
Gigyf1 C T 5: 137,523,160 probably benign Het
Gtpbp2 A C 17: 46,167,834 T526P probably damaging Het
Gys2 A G 6: 142,454,513 L324S probably damaging Het
Hpn C A 7: 31,103,356 V119L probably benign Het
Ino80d C A 1: 63,058,939 V599L probably benign Het
Kcnh3 G T 15: 99,242,394 G1054* probably null Het
Maml1 A T 11: 50,266,951 D132E probably benign Het
Mastl A T 2: 23,133,491 S407T probably benign Het
Mettl1 T C 10: 127,043,085 W3R probably damaging Het
Mprip A G 11: 59,760,573 Y1701C probably damaging Het
Mylk3 T C 8: 85,342,721 N484D probably damaging Het
Nod2 G A 8: 88,672,785 probably null Het
Nrde2 A T 12: 100,130,778 F921Y probably damaging Het
Nup88 G T 11: 70,944,908 T575N probably damaging Het
Nxpe3 T C 16: 55,866,343 T101A possibly damaging Het
Olfr1214 C T 2: 88,987,465 V246I possibly damaging Het
Olfr458 A G 6: 42,460,974 M15T probably benign Het
Olfr672 A G 7: 104,996,307 L199S possibly damaging Het
Olfr951 A T 9: 39,394,075 I92F probably damaging Het
Olfr98 T A 17: 37,263,641 T8S probably benign Het
Pcnx3 A T 19: 5,672,596 L1356Q probably damaging Het
Pkd1 A T 17: 24,594,536 M4017L probably benign Het
Polg2 A G 11: 106,779,238 C69R possibly damaging Het
Prr5l T G 2: 101,717,107 S358R probably benign Het
Ptprg A G 14: 12,154,111 T611A probably benign Het
Ryk G T 9: 102,897,317 E417* probably null Het
Sbp T C 17: 23,942,422 probably benign Het
Sema4a T C 3: 88,451,497 T155A probably benign Het
Shank3 A G 15: 89,531,711 probably null Het
Slc35d2 A T 13: 64,097,682 M294K possibly damaging Het
Slc41a3 A T 6: 90,612,171 N88I possibly damaging Het
Slit3 A G 11: 35,622,148 T534A probably benign Het
Ssx2ip A G 3: 146,436,541 probably null Het
Stard13 T C 5: 151,059,598 K648R probably damaging Het
Tanc1 A T 2: 59,795,834 T512S probably damaging Het
Tbcc T C 17: 46,891,156 V156A probably benign Het
Terf1 T G 1: 15,831,563 I273R possibly damaging Het
Tesc A G 5: 118,059,458 Y179C probably damaging Het
Ttc3 T G 16: 94,384,041 V40G probably damaging Het
Tysnd1 T A 10: 61,696,249 F227I probably damaging Het
Vps53 T C 11: 76,081,208 E271G probably damaging Het
Wdfy4 C T 14: 33,090,866 R1650H probably damaging Het
Other mutations in Fcho2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Fcho2 APN 13 98789807 missense probably benign
IGL02058:Fcho2 APN 13 98730906 missense probably damaging 0.98
IGL02516:Fcho2 APN 13 98730212 missense probably benign 0.08
IGL02715:Fcho2 APN 13 98796335 missense probably damaging 1.00
IGL03243:Fcho2 APN 13 98777384 splice site probably benign
R0044:Fcho2 UTSW 13 98755544 intron probably benign
R0087:Fcho2 UTSW 13 98735086 missense probably benign 0.00
R0472:Fcho2 UTSW 13 98748267 missense probably benign 0.01
R0501:Fcho2 UTSW 13 98764515 missense possibly damaging 0.92
R1022:Fcho2 UTSW 13 98732659 missense probably damaging 1.00
R1024:Fcho2 UTSW 13 98732659 missense probably damaging 1.00
R1130:Fcho2 UTSW 13 98748289 missense probably damaging 1.00
R1495:Fcho2 UTSW 13 98749850 critical splice donor site probably null
R1593:Fcho2 UTSW 13 98784807 missense possibly damaging 0.92
R1608:Fcho2 UTSW 13 98726198 missense probably benign 0.01
R1638:Fcho2 UTSW 13 98745895 missense possibly damaging 0.83
R1643:Fcho2 UTSW 13 98784816 missense probably benign 0.00
R2125:Fcho2 UTSW 13 98775898 missense possibly damaging 0.83
R3117:Fcho2 UTSW 13 98777438 missense probably damaging 1.00
R3968:Fcho2 UTSW 13 98735056 missense probably benign 0.06
R3970:Fcho2 UTSW 13 98735056 missense probably benign 0.06
R4079:Fcho2 UTSW 13 98755612 missense probably damaging 0.99
R4816:Fcho2 UTSW 13 98806366 missense probably damaging 1.00
R5437:Fcho2 UTSW 13 98777474 missense possibly damaging 0.95
R5457:Fcho2 UTSW 13 98789767 missense probably damaging 0.99
R5733:Fcho2 UTSW 13 98789802 missense probably damaging 0.99
R6136:Fcho2 UTSW 13 98789767 missense probably damaging 0.99
R6186:Fcho2 UTSW 13 98815083 missense probably benign 0.01
R6365:Fcho2 UTSW 13 98789859 missense probably benign 0.20
R7041:Fcho2 UTSW 13 98784826 missense possibly damaging 0.72
R7168:Fcho2 UTSW 13 98789463 missense probably benign
R7218:Fcho2 UTSW 13 98753613 intron probably null
R7243:Fcho2 UTSW 13 98755216 missense possibly damaging 0.94
R7533:Fcho2 UTSW 13 98784799 missense not run
X0018:Fcho2 UTSW 13 98732082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTTAGAACTGTTGCAGC -3'
(R):5'- GTTTTCCTAGCAACAGTCGC -3'

Sequencing Primer
(F):5'- CTTAGAACTGTTGCAGCTGGAGAC -3'
(R):5'- CAGCTGTGATTGTGCAGATTCACAG -3'
Posted On2016-08-04