Incidental Mutation 'R0487:Fgf10'
ID42367
Institutional Source Beutler Lab
Gene Symbol Fgf10
Ensembl Gene ENSMUSG00000021732
Gene Namefibroblast growth factor 10
SynonymsGsfaey17, AEY17, FGF-10
MMRRC Submission 038686-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0487 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location118669791-118792115 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 118781611 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022246]
Predicted Effect probably null
Transcript: ENSMUST00000022246
SMART Domains Protein: ENSMUSP00000022246
Gene: ENSMUSG00000021732

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
FGF 77 206 9.61e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146674
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein exhibits mitogenic activity for keratinizing epidermal cells, but essentially no activity for fibroblasts, which is similar to the biological activity of FGF7. Studies of the mouse homolog of suggested that this gene is required for embryonic epidermal morphogenesis including brain development, lung morphogenesis, and initiation of lim bud formation. This gene is also implicated to be a primary factor in the process of wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die at birth with multiple abnormalities including absence of lungs, severely truncated limbs, open eyelids, incomplete external genitalia, arrested pancreatic development, lack of mammary glands and impaired epidermal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,331,687 M3190L probably benign Het
Adgrv1 A T 13: 81,489,035 L3429H probably damaging Het
Ahnak A G 19: 9,007,151 N1933S probably benign Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
AI314180 A G 4: 58,819,155 V1265A probably damaging Het
Amacr A G 15: 10,984,749 D151G probably benign Het
Ano9 A T 7: 141,107,849 H255Q possibly damaging Het
Asphd2 A T 5: 112,391,635 Y111N probably damaging Het
Cage1 T A 13: 38,025,358 K214N probably benign Het
Cdkn2c A G 4: 109,661,409 L116P probably damaging Het
Cltc C T 11: 86,733,664 R148H probably damaging Het
Cmbl A G 15: 31,582,030 N58D probably damaging Het
Cpa6 T C 1: 10,409,262 T249A possibly damaging Het
Cpsf1 T A 15: 76,597,002 N1218I probably damaging Het
Csf2rb T C 15: 78,348,331 S613P probably benign Het
Ctnnd1 A G 2: 84,609,067 S761P probably damaging Het
Cxcr6 A C 9: 123,810,398 I155L probably benign Het
Fam216a A G 5: 122,370,513 probably null Het
Fgf17 T C 14: 70,638,556 T79A probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm1527 G T 3: 28,926,679 V643L probably benign Het
Gm7534 A T 4: 134,202,778 L72Q probably damaging Het
Hmcn2 A T 2: 31,386,677 Q1556L possibly damaging Het
Hrasls G A 16: 29,220,579 probably null Het
Hspa4l C T 3: 40,784,326 T616I possibly damaging Het
Irgm1 T C 11: 48,866,327 D219G probably damaging Het
Jcad A G 18: 4,673,243 D335G probably damaging Het
Kcnh4 A G 11: 100,750,258 F455S probably damaging Het
Khdrbs3 T C 15: 69,017,361 Y120H probably damaging Het
Kndc1 A T 7: 139,914,023 T507S probably null Het
Lepr G T 4: 101,768,093 E482* probably null Het
Lrmp A G 6: 145,165,260 S264G probably benign Het
Mcemp1 T A 8: 3,667,507 M146K probably benign Het
Mllt10 A G 2: 18,207,137 T411A probably damaging Het
Myh8 A T 11: 67,302,011 I1543L probably benign Het
Myo1f T C 17: 33,578,284 S147P probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Olfr1106 C T 2: 87,048,493 V248I probably damaging Het
Plch2 G A 4: 155,009,012 R57C probably damaging Het
Rbm20 G A 19: 53,851,195 G872R probably damaging Het
Retsat A T 6: 72,606,431 I373F probably damaging Het
Rnf145 T C 11: 44,555,229 F297L probably benign Het
Ros1 A T 10: 52,155,108 M479K possibly damaging Het
Rubcnl T A 14: 75,036,081 N244K probably benign Het
Samhd1 A G 2: 157,110,615 F406L probably damaging Het
Sdsl A T 5: 120,459,468 V258D probably damaging Het
Sec24c C G 14: 20,683,399 P166A probably benign Het
Sele C A 1: 164,053,615 Y461* probably null Het
Slc22a1 G T 17: 12,662,600 S334* probably null Het
Spem1 T G 11: 69,821,865 probably null Het
Stat3 T C 11: 100,903,643 E280G probably damaging Het
Stxbp4 T C 11: 90,592,360 H280R probably benign Het
Tas2r129 G A 6: 132,951,943 C281Y probably benign Het
Tas2r129 T G 6: 132,951,944 C281W probably benign Het
Tcp11 T A 17: 28,079,923 probably null Het
Tnrc6b G A 15: 80,880,675 V793M probably benign Het
Vmn2r59 A C 7: 42,047,104 Y71* probably null Het
Wdr35 T C 12: 9,012,743 probably null Het
Zan A G 5: 137,413,358 probably null Het
Zap70 G T 1: 36,779,284 V351L probably damaging Het
Zfp609 G T 9: 65,702,634 Q1016K unknown Het
Zfp641 C A 15: 98,289,179 V188L probably benign Het
Other mutations in Fgf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03400:Fgf10 APN 13 118781615 splice site probably null
R0789:Fgf10 UTSW 13 118789205 missense probably benign
R1876:Fgf10 UTSW 13 118789159 missense probably damaging 1.00
R1939:Fgf10 UTSW 13 118789152 missense probably damaging 1.00
R2032:Fgf10 UTSW 13 118715595 missense probably damaging 1.00
R3768:Fgf10 UTSW 13 118781547 missense probably damaging 1.00
R3769:Fgf10 UTSW 13 118781547 missense probably damaging 1.00
R4756:Fgf10 UTSW 13 118781509 missense probably benign 0.03
R5992:Fgf10 UTSW 13 118715508 missense probably benign 0.00
R6289:Fgf10 UTSW 13 118715492 missense probably benign 0.01
R6301:Fgf10 UTSW 13 118715511 missense probably benign 0.02
R6755:Fgf10 UTSW 13 118789285 missense probably damaging 1.00
R7174:Fgf10 UTSW 13 118715406 missense probably benign 0.39
R7189:Fgf10 UTSW 13 118789123 missense probably benign 0.02
X0024:Fgf10 UTSW 13 118715544 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGGAGGGACAACCTCTCAAAGCC -3'
(R):5'- GTTGAACAAGCTGTTTGCCAGCC -3'

Sequencing Primer
(F):5'- GGGGTTTTCAACACGTTCAAC -3'
(R):5'- CCTTGAGATGCTGCGAATCC -3'
Posted On2013-05-23