Incidental Mutation 'R5338:Pcnx3'
ID423672
Institutional Source Beutler Lab
Gene Symbol Pcnx3
Ensembl Gene ENSMUSG00000054874
Gene Namepecanex homolog 3
SynonymsPcnxl3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R5338 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location5664635-5688908 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5672596 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1356 (L1356Q)
Ref Sequence ENSEMBL: ENSMUSP00000109245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068169] [ENSMUST00000113615]
Predicted Effect probably damaging
Transcript: ENSMUST00000068169
AA Change: L948Q

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000063786
Gene: ENSMUSG00000054874
AA Change: L948Q

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 370 376 N/A INTRINSIC
transmembrane domain 385 407 N/A INTRINSIC
transmembrane domain 411 428 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 501 523 N/A INTRINSIC
transmembrane domain 538 560 N/A INTRINSIC
transmembrane domain 573 592 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
transmembrane domain 669 691 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Pfam:Pecanex_C 1159 1389 7.5e-124 PFAM
low complexity region 1462 1479 N/A INTRINSIC
low complexity region 1481 1510 N/A INTRINSIC
low complexity region 1525 1538 N/A INTRINSIC
low complexity region 1558 1569 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113615
AA Change: L1356Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109245
Gene: ENSMUSG00000054874
AA Change: L1356Q

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 438 459 N/A INTRINSIC
low complexity region 778 784 N/A INTRINSIC
transmembrane domain 793 815 N/A INTRINSIC
transmembrane domain 819 836 N/A INTRINSIC
transmembrane domain 849 871 N/A INTRINSIC
transmembrane domain 881 900 N/A INTRINSIC
transmembrane domain 909 931 N/A INTRINSIC
transmembrane domain 946 968 N/A INTRINSIC
transmembrane domain 981 1000 N/A INTRINSIC
transmembrane domain 1053 1075 N/A INTRINSIC
transmembrane domain 1077 1099 N/A INTRINSIC
low complexity region 1419 1433 N/A INTRINSIC
Pfam:Pecanex_C 1570 1796 5.9e-116 PFAM
low complexity region 1870 1887 N/A INTRINSIC
low complexity region 1889 1918 N/A INTRINSIC
low complexity region 1933 1946 N/A INTRINSIC
low complexity region 1966 1977 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137313
SMART Domains Protein: ENSMUSP00000115217
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 79 98 N/A INTRINSIC
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145270
SMART Domains Protein: ENSMUSP00000116493
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
low complexity region 199 205 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 240 257 N/A INTRINSIC
transmembrane domain 270 292 N/A INTRINSIC
transmembrane domain 302 321 N/A INTRINSIC
transmembrane domain 330 352 N/A INTRINSIC
transmembrane domain 367 389 N/A INTRINSIC
transmembrane domain 402 421 N/A INTRINSIC
transmembrane domain 474 496 N/A INTRINSIC
transmembrane domain 498 520 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146638
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T A 9: 99,620,544 N252K probably damaging Het
Abhd16a A G 17: 35,094,302 E132G probably damaging Het
Adgrv1 G A 13: 81,529,046 R1889W possibly damaging Het
Aftph A T 11: 20,727,203 D135E probably benign Het
Arf1 A C 11: 59,213,215 F63V probably damaging Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
B3gnt7 T A 1: 86,305,644 F87Y probably damaging Het
Bcat1 A G 6: 145,007,627 Y345H possibly damaging Het
Birc3 G T 9: 7,857,359 T371K probably benign Het
Ccdc175 A T 12: 72,184,971 S5T probably damaging Het
Ccdc186 A T 19: 56,813,257 S143T possibly damaging Het
Cct6b A T 11: 82,762,189 M28K possibly damaging Het
Cers4 C A 8: 4,515,680 A42D probably damaging Het
Crmp1 G T 5: 37,279,674 V236L probably benign Het
Ctdspl2 T A 2: 121,981,312 N212K probably benign Het
Dclk3 T C 9: 111,469,059 V557A possibly damaging Het
Dnmt1 A T 9: 20,952,719 H23Q probably benign Het
Dpp8 G T 9: 65,063,924 E609* probably null Het
Dtx3 C A 10: 127,193,050 M106I probably benign Het
Ero1lb A C 13: 12,574,851 D45A probably damaging Het
Fcho2 T A 13: 98,730,891 D688V probably damaging Het
Fhod3 A T 18: 25,028,081 S557C probably damaging Het
Flnc T C 6: 29,444,064 S626P possibly damaging Het
Foxi3 G T 6: 70,960,618 G278V probably damaging Het
Gbp10 A G 5: 105,224,300 L198P probably damaging Het
Gcn1l1 A G 5: 115,583,403 T458A probably benign Het
Gigyf1 C T 5: 137,523,160 probably benign Het
Gtpbp2 A C 17: 46,167,834 T526P probably damaging Het
Gys2 A G 6: 142,454,513 L324S probably damaging Het
Hpn C A 7: 31,103,356 V119L probably benign Het
Ino80d C A 1: 63,058,939 V599L probably benign Het
Kcnh3 G T 15: 99,242,394 G1054* probably null Het
Maml1 A T 11: 50,266,951 D132E probably benign Het
Mastl A T 2: 23,133,491 S407T probably benign Het
Mettl1 T C 10: 127,043,085 W3R probably damaging Het
Mprip A G 11: 59,760,573 Y1701C probably damaging Het
Mylk3 T C 8: 85,342,721 N484D probably damaging Het
Nod2 G A 8: 88,672,785 probably null Het
Nrde2 A T 12: 100,130,778 F921Y probably damaging Het
Nup88 G T 11: 70,944,908 T575N probably damaging Het
Nxpe3 T C 16: 55,866,343 T101A possibly damaging Het
Olfr1214 C T 2: 88,987,465 V246I possibly damaging Het
Olfr458 A G 6: 42,460,974 M15T probably benign Het
Olfr672 A G 7: 104,996,307 L199S possibly damaging Het
Olfr951 A T 9: 39,394,075 I92F probably damaging Het
Olfr98 T A 17: 37,263,641 T8S probably benign Het
Pkd1 A T 17: 24,594,536 M4017L probably benign Het
Polg2 A G 11: 106,779,238 C69R possibly damaging Het
Prr5l T G 2: 101,717,107 S358R probably benign Het
Ptprg A G 14: 12,154,111 T611A probably benign Het
Ryk G T 9: 102,897,317 E417* probably null Het
Sbp T C 17: 23,942,422 probably benign Het
Sema4a T C 3: 88,451,497 T155A probably benign Het
Shank3 A G 15: 89,531,711 probably null Het
Slc35d2 A T 13: 64,097,682 M294K possibly damaging Het
Slc41a3 A T 6: 90,612,171 N88I possibly damaging Het
Slit3 A G 11: 35,622,148 T534A probably benign Het
Ssx2ip A G 3: 146,436,541 probably null Het
Stard13 T C 5: 151,059,598 K648R probably damaging Het
Tanc1 A T 2: 59,795,834 T512S probably damaging Het
Tbcc T C 17: 46,891,156 V156A probably benign Het
Terf1 T G 1: 15,831,563 I273R possibly damaging Het
Tesc A G 5: 118,059,458 Y179C probably damaging Het
Ttc3 T G 16: 94,384,041 V40G probably damaging Het
Tysnd1 T A 10: 61,696,249 F227I probably damaging Het
Vps53 T C 11: 76,081,208 E271G probably damaging Het
Wdfy4 C T 14: 33,090,866 R1650H probably damaging Het
Other mutations in Pcnx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Pcnx3 APN 19 5667259 unclassified probably benign
IGL01667:Pcnx3 APN 19 5686630 missense probably benign 0.03
IGL01704:Pcnx3 APN 19 5667476 missense probably damaging 1.00
IGL01752:Pcnx3 APN 19 5665337 nonsense probably null
IGL01791:Pcnx3 APN 19 5673267 missense probably benign 0.39
IGL01937:Pcnx3 APN 19 5677663 missense probably benign
IGL01987:Pcnx3 APN 19 5677479 missense probably damaging 1.00
IGL02073:Pcnx3 APN 19 5679386 missense probably damaging 0.99
IGL02417:Pcnx3 APN 19 5686481 missense possibly damaging 0.92
IGL03143:Pcnx3 APN 19 5685395 missense probably damaging 1.00
PIT4453001:Pcnx3 UTSW 19 5672756 critical splice donor site probably null
R0234:Pcnx3 UTSW 19 5672618 missense probably benign 0.12
R0234:Pcnx3 UTSW 19 5672618 missense probably benign 0.12
R0360:Pcnx3 UTSW 19 5665583 missense probably damaging 0.98
R0687:Pcnx3 UTSW 19 5684333 missense probably damaging 1.00
R0718:Pcnx3 UTSW 19 5677728 splice site probably benign
R0840:Pcnx3 UTSW 19 5685701 unclassified probably null
R0907:Pcnx3 UTSW 19 5671525 missense possibly damaging 0.95
R1251:Pcnx3 UTSW 19 5677182 missense probably benign 0.03
R1373:Pcnx3 UTSW 19 5665516 missense probably damaging 0.97
R1467:Pcnx3 UTSW 19 5674894 missense possibly damaging 0.63
R1467:Pcnx3 UTSW 19 5674894 missense possibly damaging 0.63
R1572:Pcnx3 UTSW 19 5685347 nonsense probably null
R1602:Pcnx3 UTSW 19 5672515 missense probably damaging 1.00
R1628:Pcnx3 UTSW 19 5686065 missense probably damaging 0.99
R1635:Pcnx3 UTSW 19 5665745 missense probably benign 0.00
R1670:Pcnx3 UTSW 19 5673315 missense probably damaging 1.00
R1889:Pcnx3 UTSW 19 5672656 missense probably damaging 1.00
R1898:Pcnx3 UTSW 19 5672587 missense probably damaging 1.00
R2113:Pcnx3 UTSW 19 5671556 missense possibly damaging 0.93
R2147:Pcnx3 UTSW 19 5667605 missense probably damaging 1.00
R2358:Pcnx3 UTSW 19 5683339 nonsense probably null
R2358:Pcnx3 UTSW 19 5683340 start codon destroyed probably null
R2871:Pcnx3 UTSW 19 5683746 intron probably benign
R3699:Pcnx3 UTSW 19 5672465 missense probably damaging 1.00
R3712:Pcnx3 UTSW 19 5683339 nonsense probably null
R3712:Pcnx3 UTSW 19 5683340 start codon destroyed probably null
R3798:Pcnx3 UTSW 19 5678668 nonsense probably null
R3856:Pcnx3 UTSW 19 5678967 missense probably benign 0.02
R3953:Pcnx3 UTSW 19 5683780 splice site probably benign
R4613:Pcnx3 UTSW 19 5667219 missense possibly damaging 0.51
R4781:Pcnx3 UTSW 19 5687130 missense probably damaging 0.99
R4816:Pcnx3 UTSW 19 5687995 critical splice donor site probably null
R5770:Pcnx3 UTSW 19 5681579 intron probably benign
R5950:Pcnx3 UTSW 19 5667158 missense possibly damaging 0.81
R5951:Pcnx3 UTSW 19 5671680 missense possibly damaging 0.71
R5969:Pcnx3 UTSW 19 5685535 missense probably damaging 1.00
R6543:Pcnx3 UTSW 19 5665247 missense probably benign 0.07
R6704:Pcnx3 UTSW 19 5686487 missense possibly damaging 0.74
R7096:Pcnx3 UTSW 19 5672615 missense probably damaging 1.00
X0028:Pcnx3 UTSW 19 5684427 missense probably damaging 1.00
X0053:Pcnx3 UTSW 19 5686622 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAATCTTGTGTCCCAGCCCAG -3'
(R):5'- GACCATTCTAACACTCGCCTAG -3'

Sequencing Primer
(F):5'- TGCTAGTCTCCCAGCTCAGG -3'
(R):5'- ACTCGCCTAGTGACACAGCTG -3'
Posted On2016-08-04