Incidental Mutation 'R5339:Chrna7'
ID 423693
Institutional Source Beutler Lab
Gene Symbol Chrna7
Ensembl Gene ENSMUSG00000030525
Gene Name cholinergic receptor, nicotinic, alpha polypeptide 7
Synonyms alpha7 nicotinic receptor, alpha7, alpha7-nAChR, Acra7
MMRRC Submission 042918-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5339 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 62748440-62862274 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 62749055 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 476 (S476P)
Ref Sequence ENSEMBL: ENSMUSP00000032738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032738]
AlphaFold P49582
Predicted Effect probably damaging
Transcript: ENSMUST00000032738
AA Change: S476P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032738
Gene: ENSMUSG00000030525
AA Change: S476P

DomainStartEndE-ValueType
low complexity region 10 17 N/A INTRINSIC
Pfam:Neur_chan_LBD 26 230 1e-75 PFAM
Pfam:Neur_chan_memb 237 487 3.6e-63 PFAM
Meta Mutation Damage Score 0.5663 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are thought to be hetero-pentamers composed of homologous subunits. The proposed structure for each subunit is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. The protein encoded by this gene forms a homo-oligomeric channel, displays marked permeability to calcium ions and is a major component of brain nicotinic receptors that are blocked by, and highly sensitive to, alpha-bungarotoxin. Once this receptor binds acetylcholine, it undergoes an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. This gene is located in a region identified as a major susceptibility locus for juvenile myoclonic epilepsy and a chromosomal location involved in the genetic transmission of schizophrenia. An evolutionarily recent partial duplication event in this region results in a hybrid containing sequence from this gene and a novel FAM7A gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
PHENOTYPE: Nullizygous mice lack hippocampal fast nicotinic currents but show nicotine-induced seizures as well as altered anxiety behavior, fertility defects, airway basal cell hyperplasia. and higher TNF sythesis when endotoxemic. Newborns homozygous for a knock-in allele die with increased neuron apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb C T 10: 10,318,350 (GRCm39) G158E probably damaging Het
Adgrl2 C T 3: 148,523,480 (GRCm39) R1256H probably benign Het
C3 C A 17: 57,531,308 (GRCm39) V329F probably damaging Het
Ccdc50 C T 16: 27,236,055 (GRCm39) H130Y probably damaging Het
Crtc1 A T 8: 70,850,383 (GRCm39) probably benign Het
Dnah12 A G 14: 26,536,494 (GRCm39) T2137A possibly damaging Het
Ehd3 G A 17: 74,135,202 (GRCm39) M359I possibly damaging Het
Fastkd3 G A 13: 68,738,283 (GRCm39) G611R probably damaging Het
Foxa2 T A 2: 147,886,354 (GRCm39) S154C probably damaging Het
Gfm2 T C 13: 97,311,548 (GRCm39) I733T probably benign Het
Gm1968 T C 16: 29,781,077 (GRCm39) noncoding transcript Het
Gmfg-ps T C 6: 4,893,401 (GRCm39) noncoding transcript Het
Gzmd A T 14: 56,368,140 (GRCm39) N106K possibly damaging Het
Huwe1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA X: 150,690,044 (GRCm39) probably benign Het
Ipo5 T C 14: 121,181,122 (GRCm39) W883R probably damaging Het
Itpr1 T A 6: 108,370,922 (GRCm39) V1063D probably damaging Het
Kansl3 A C 1: 36,406,802 (GRCm39) probably benign Het
Klkb1 C A 8: 45,723,748 (GRCm39) V556F possibly damaging Het
Krtap14 C A 16: 88,622,747 (GRCm39) R77S probably benign Het
Leng8 T A 7: 4,148,285 (GRCm39) Y686N possibly damaging Het
Mctp1 C A 13: 76,973,825 (GRCm39) probably benign Het
Moxd2 T C 6: 40,862,354 (GRCm39) Y155C probably damaging Het
Ofcc1 A G 13: 40,241,321 (GRCm39) V729A probably benign Het
Or2w6 G A 13: 21,843,404 (GRCm39) L30F probably benign Het
Or4k1 C A 14: 50,377,759 (GRCm39) M112I probably damaging Het
Or7g27 G A 9: 19,250,455 (GRCm39) G233E possibly damaging Het
Or8g30 A T 9: 39,230,599 (GRCm39) F104I possibly damaging Het
Or8g37 T A 9: 39,731,229 (GRCm39) M98K probably damaging Het
Pdia4 C T 6: 47,773,619 (GRCm39) A577T possibly damaging Het
Pex5 A T 6: 124,374,963 (GRCm39) S629T probably benign Het
Pnpla7 T C 2: 24,892,949 (GRCm39) S146P probably benign Het
Prune2 G A 19: 17,098,236 (GRCm39) E1247K probably damaging Het
Reg3a A G 6: 78,360,522 (GRCm39) probably null Het
Snx8 G A 5: 140,343,905 (GRCm39) R78C probably damaging Het
Sstr5 T C 17: 25,710,173 (GRCm39) E352G probably benign Het
Svep1 T C 4: 58,121,892 (GRCm39) Y767C possibly damaging Het
Tbx15 G A 3: 99,223,600 (GRCm39) V263M possibly damaging Het
Tdrd9 T C 12: 111,993,556 (GRCm39) Y695H probably damaging Het
Tep1 A T 14: 51,082,031 (GRCm39) L1174Q probably damaging Het
Tg T A 15: 66,549,942 (GRCm39) Y235N probably damaging Het
Tha1 C A 11: 117,761,908 (GRCm39) R111L possibly damaging Het
Trim17 C T 11: 58,845,336 (GRCm39) probably null Het
Trim72 A G 7: 127,609,505 (GRCm39) T436A probably benign Het
Uba7 C T 9: 107,856,065 (GRCm39) A480V probably damaging Het
Ublcp1 A T 11: 44,346,435 (GRCm39) S313T probably benign Het
Ubqlnl A G 7: 103,798,972 (GRCm39) V175A probably benign Het
Vps26a A G 10: 62,294,746 (GRCm39) L276P probably damaging Het
Zdhhc21 C T 4: 82,756,550 (GRCm39) G110S probably damaging Het
Zfp236 T C 18: 82,642,491 (GRCm39) E1133G probably damaging Het
Zfp800 A T 6: 28,256,472 (GRCm39) S39T probably damaging Het
Other mutations in Chrna7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01776:Chrna7 APN 7 62,749,267 (GRCm39) missense probably benign 0.01
IGL01999:Chrna7 APN 7 62,753,539 (GRCm39) missense probably damaging 1.00
IGL02016:Chrna7 APN 7 62,753,583 (GRCm39) missense probably damaging 1.00
IGL02388:Chrna7 APN 7 62,757,439 (GRCm39) missense probably damaging 1.00
IGL02400:Chrna7 APN 7 62,749,070 (GRCm39) missense probably damaging 1.00
IGL02458:Chrna7 APN 7 62,755,842 (GRCm39) missense probably damaging 1.00
IGL03039:Chrna7 APN 7 62,798,340 (GRCm39) missense probably damaging 1.00
inflation UTSW 7 62,798,349 (GRCm39) missense probably damaging 1.00
thaler UTSW 7 62,755,775 (GRCm39) missense probably damaging 1.00
R0034:Chrna7 UTSW 7 62,798,354 (GRCm39) missense possibly damaging 0.79
R0631:Chrna7 UTSW 7 62,749,391 (GRCm39) missense probably benign 0.00
R1666:Chrna7 UTSW 7 62,861,890 (GRCm39) missense possibly damaging 0.70
R1703:Chrna7 UTSW 7 62,749,255 (GRCm39) missense probably damaging 0.99
R1763:Chrna7 UTSW 7 62,749,000 (GRCm39) missense probably benign 0.05
R1974:Chrna7 UTSW 7 62,749,034 (GRCm39) missense probably damaging 1.00
R2294:Chrna7 UTSW 7 62,760,172 (GRCm39) missense probably benign 0.11
R2393:Chrna7 UTSW 7 62,748,994 (GRCm39) missense probably damaging 1.00
R4598:Chrna7 UTSW 7 62,753,538 (GRCm39) missense probably damaging 1.00
R4599:Chrna7 UTSW 7 62,753,538 (GRCm39) missense probably damaging 1.00
R4842:Chrna7 UTSW 7 62,862,196 (GRCm39) missense probably benign 0.05
R5143:Chrna7 UTSW 7 62,755,895 (GRCm39) missense probably damaging 1.00
R5310:Chrna7 UTSW 7 62,755,805 (GRCm39) missense probably damaging 1.00
R5516:Chrna7 UTSW 7 62,749,046 (GRCm39) missense probably damaging 0.98
R5807:Chrna7 UTSW 7 62,798,349 (GRCm39) missense probably damaging 1.00
R6501:Chrna7 UTSW 7 62,755,863 (GRCm39) missense probably damaging 1.00
R6918:Chrna7 UTSW 7 62,809,299 (GRCm39) missense probably benign 0.03
R7000:Chrna7 UTSW 7 62,755,787 (GRCm39) missense probably damaging 1.00
R7189:Chrna7 UTSW 7 62,755,775 (GRCm39) missense probably damaging 1.00
R7483:Chrna7 UTSW 7 62,754,738 (GRCm39) missense probably damaging 1.00
R7953:Chrna7 UTSW 7 62,753,541 (GRCm39) missense possibly damaging 0.82
R7955:Chrna7 UTSW 7 62,753,541 (GRCm39) missense possibly damaging 0.82
R7956:Chrna7 UTSW 7 62,753,541 (GRCm39) missense possibly damaging 0.82
R8235:Chrna7 UTSW 7 62,861,972 (GRCm39) missense probably damaging 1.00
R9125:Chrna7 UTSW 7 62,757,357 (GRCm39) nonsense probably null
R9356:Chrna7 UTSW 7 62,757,437 (GRCm39) missense probably damaging 1.00
R9694:Chrna7 UTSW 7 62,754,809 (GRCm39) missense probably damaging 1.00
Z1176:Chrna7 UTSW 7 62,861,932 (GRCm39) missense probably damaging 1.00
Z1177:Chrna7 UTSW 7 62,757,299 (GRCm39) critical splice donor site probably null
Z1191:Chrna7 UTSW 7 62,755,941 (GRCm39) missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- AAACAGAAGCTGCTGGGATC -3'
(R):5'- GCTCCCCAACACATGATGAG -3'

Sequencing Primer
(F):5'- AACAGAAGCTGCTGGGATCTTTTTAG -3'
(R):5'- CCAACACATGATGAGCACCTC -3'
Posted On 2016-08-04