Incidental Mutation 'R5339:Crtc1'
ID423698
Institutional Source Beutler Lab
Gene Symbol Crtc1
Ensembl Gene ENSMUSG00000003575
Gene NameCREB regulated transcription coactivator 1
SynonymsMect1, TORC1
MMRRC Submission 042918-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.372) question?
Stock #R5339 (G1)
Quality Score145
Status Validated
Chromosome8
Chromosomal Location70382355-70439579 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 70397733 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076615]
Predicted Effect probably benign
Transcript: ENSMUST00000076615
SMART Domains Protein: ENSMUSP00000075916
Gene: ENSMUSG00000003575

DomainStartEndE-ValueType
Pfam:TORC_N 6 66 1.1e-26 PFAM
Pfam:TORC_M 148 289 4.8e-64 PFAM
low complexity region 359 394 N/A INTRINSIC
Pfam:TORC_C 555 630 9.2e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142769
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (57/59)
MGI Phenotype PHENOTYPE: Mice homozygous for an inactivating mutation in this gene are hyperphagic, obese and infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb C T 10: 10,442,606 G158E probably damaging Het
Adgrl2 C T 3: 148,817,844 R1256H probably benign Het
C3 C A 17: 57,224,308 V329F probably damaging Het
Ccdc50 C T 16: 27,417,305 H130Y probably damaging Het
Chrna7 A G 7: 63,099,307 S476P probably damaging Het
Dnah12 A G 14: 26,814,537 T2137A possibly damaging Het
Ehd3 G A 17: 73,828,207 M359I possibly damaging Het
Fastkd3 G A 13: 68,590,164 G611R probably damaging Het
Foxa2 T A 2: 148,044,434 S154C probably damaging Het
Gfm2 T C 13: 97,175,040 I733T probably benign Het
Gm1968 T C 16: 29,962,259 noncoding transcript Het
Gmfg-ps T C 6: 4,893,401 noncoding transcript Het
Gzmd A T 14: 56,130,683 N106K possibly damaging Het
Huwe1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA X: 151,907,048 probably benign Het
Ipo5 T C 14: 120,943,710 W883R probably damaging Het
Itpr1 T A 6: 108,393,961 V1063D probably damaging Het
Kansl3 A C 1: 36,367,721 probably benign Het
Klkb1 C A 8: 45,270,711 V556F possibly damaging Het
Krtap14 C A 16: 88,825,859 R77S probably benign Het
Leng8 T A 7: 4,145,286 Y686N possibly damaging Het
Mctp1 C A 13: 76,825,706 probably benign Het
Moxd2 T C 6: 40,885,420 Y155C probably damaging Het
Ofcc1 A G 13: 40,087,845 V729A probably benign Het
Olfr1361 G A 13: 21,659,234 L30F probably benign Het
Olfr728 C A 14: 50,140,302 M112I probably damaging Het
Olfr845 G A 9: 19,339,159 G233E possibly damaging Het
Olfr948 A T 9: 39,319,303 F104I possibly damaging Het
Olfr970 T A 9: 39,819,933 M98K probably damaging Het
Pdia4 C T 6: 47,796,685 A577T possibly damaging Het
Pex5 A T 6: 124,398,004 S629T probably benign Het
Pnpla7 T C 2: 25,002,937 S146P probably benign Het
Prune2 G A 19: 17,120,872 E1247K probably damaging Het
Reg3a A G 6: 78,383,539 probably null Het
Snx8 G A 5: 140,358,150 R78C probably damaging Het
Sstr5 T C 17: 25,491,199 E352G probably benign Het
Svep1 T C 4: 58,121,892 Y767C possibly damaging Het
Tbx15 G A 3: 99,316,284 V263M possibly damaging Het
Tdrd9 T C 12: 112,027,122 Y695H probably damaging Het
Tep1 A T 14: 50,844,574 L1174Q probably damaging Het
Tg T A 15: 66,678,093 Y235N probably damaging Het
Tha1 C A 11: 117,871,082 R111L possibly damaging Het
Trim17 C T 11: 58,954,510 probably null Het
Trim72 A G 7: 128,010,333 T436A probably benign Het
Uba7 C T 9: 107,978,866 A480V probably damaging Het
Ublcp1 A T 11: 44,455,608 S313T probably benign Het
Ubqlnl A G 7: 104,149,765 V175A probably benign Het
Vps26a A G 10: 62,458,967 L276P probably damaging Het
Zdhhc21 C T 4: 82,838,313 G110S probably damaging Het
Zfp236 T C 18: 82,624,366 E1133G probably damaging Het
Zfp800 A T 6: 28,256,473 S39T probably damaging Het
Other mutations in Crtc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Crtc1 APN 8 70439522 missense probably benign 0.01
IGL01361:Crtc1 APN 8 70387603 missense probably damaging 1.00
IGL02883:Crtc1 APN 8 70406125 missense probably benign 0.28
R0049:Crtc1 UTSW 8 70391859 critical splice donor site probably null
R0196:Crtc1 UTSW 8 70386221 missense probably damaging 1.00
R0514:Crtc1 UTSW 8 70402429 critical splice donor site probably null
R0588:Crtc1 UTSW 8 70439549 missense probably damaging 0.99
R0744:Crtc1 UTSW 8 70393013 missense probably benign 0.00
R0833:Crtc1 UTSW 8 70393013 missense probably benign 0.00
R0836:Crtc1 UTSW 8 70393013 missense probably benign 0.00
R0905:Crtc1 UTSW 8 70391255 missense probably damaging 1.00
R1016:Crtc1 UTSW 8 70392119 nonsense probably null
R1300:Crtc1 UTSW 8 70387539 critical splice donor site probably null
R1533:Crtc1 UTSW 8 70398299 missense probably damaging 1.00
R1843:Crtc1 UTSW 8 70388152 missense probably benign 0.00
R2393:Crtc1 UTSW 8 70388158 missense probably benign
R4867:Crtc1 UTSW 8 70402514 missense probably damaging 1.00
R6062:Crtc1 UTSW 8 70406189 missense probably damaging 1.00
R6342:Crtc1 UTSW 8 70439557 start codon destroyed probably null 0.95
R6912:Crtc1 UTSW 8 70398311 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATAAGCAACCAGGTCAAAG -3'
(R):5'- CAGCATCTTTCCGTCTGCAG -3'

Sequencing Primer
(F):5'- CCAGGTCAAAGCCATCAGGG -3'
(R):5'- TTTCCGTCTGCAGACCAGGAG -3'
Posted On2016-08-04