Incidental Mutation 'R5350:Tmprss11d'
ID423744
Institutional Source Beutler Lab
Gene Symbol Tmprss11d
Ensembl Gene ENSMUSG00000061259
Gene Nametransmembrane protease, serine 11d
SynonymsAsP
MMRRC Submission 042929-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5350 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location86302217-86373420 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86338887 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 48 (Y48C)
Ref Sequence ENSEMBL: ENSMUSP00000031175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031175]
PDB Structure
Crystal structure of SEA domain of transmembrane protease from Mus musculus [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000031175
AA Change: Y48C

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000031175
Gene: ENSMUSG00000061259
AA Change: Y48C

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
SEA 41 164 4.92e-2 SMART
Tryp_SPc 185 411 1.29e-86 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a trypsin-like serine protease released from the submucosal serous glands onto mucous membrane. It is a type II integral membrane protein and has 29-38% identity in the sequence of the catalytic region with human hepsin, enteropeptidase, acrosin, and mast cell tryptase. The noncatalytic region has little similarity to other known proteins. This protein may play some biological role in the host defense system on the mucous membrane independently of or in cooperation with other substances in airway mucous or bronchial secretions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aged female mice homozygous for a knock-in allele exhibit increased lymphoma incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G A 11: 110,319,796 Q186* probably null Het
Abca9 A G 11: 110,115,538 V1247A probably benign Het
Acaca A T 11: 84,215,873 M133L probably damaging Het
Acacb C T 5: 114,244,551 A2100V probably damaging Het
Adamts16 T A 13: 70,753,196 K921* probably null Het
Ankrd55 T G 13: 112,336,226 V144G probably damaging Het
Arap3 A G 18: 37,982,035 L976P probably damaging Het
Atg2a T A 19: 6,251,338 V814E probably damaging Het
Atp2b2 A T 6: 113,759,238 M960K probably damaging Het
Bag1 C T 4: 40,948,007 G66S possibly damaging Het
Bmp8a A T 4: 123,313,295 M391K probably damaging Het
Capns1 C A 7: 30,190,126 R216L probably damaging Het
Cdk13 T C 13: 17,803,930 probably benign Het
Cmtm3 T C 8: 104,343,833 F75L probably damaging Het
Cops4 T A 5: 100,518,539 D21E possibly damaging Het
Dach1 G T 14: 97,969,959 A318E probably damaging Het
Ddx27 A G 2: 167,027,860 probably benign Het
Disp2 A G 2: 118,787,575 T201A probably benign Het
Dnah2 G T 11: 69,516,036 D214E possibly damaging Het
Dnah7b G T 1: 46,233,689 G2326C probably benign Het
Dusp5 T C 19: 53,541,234 F356S probably damaging Het
Duxf3 C A 10: 58,231,093 S528I probably damaging Het
Ell T A 8: 70,539,789 V28E probably damaging Het
Evi5 C T 5: 107,815,678 D344N probably benign Het
Fv1 G T 4: 147,870,089 V371L possibly damaging Het
Gemin5 A G 11: 58,141,586 probably null Het
Glce A T 9: 62,060,305 Y521* probably null Het
Grn T A 11: 102,436,244 L556Q possibly damaging Het
Icam1 C A 9: 21,027,886 Y518* probably null Het
Jag2 A T 12: 112,908,922 S1237R possibly damaging Het
Macf1 A T 4: 123,527,458 M1K probably null Het
Nbea T C 3: 56,019,424 E786G probably damaging Het
Nr4a2 A G 2: 57,111,865 M192T probably damaging Het
Olfr1246 T A 2: 89,591,088 E9V possibly damaging Het
Olfr1396 T C 11: 49,113,052 T225A probably benign Het
Olfr591 T A 7: 103,173,559 H26L probably damaging Het
Olfr860 A T 9: 19,846,616 M1K probably null Het
Pcnx4 A C 12: 72,579,364 N1115H probably damaging Het
Ppargc1b A G 18: 61,309,063 S585P possibly damaging Het
Ppip5k2 C T 1: 97,721,128 S1024N probably damaging Het
Prkar1b C T 5: 139,106,628 E145K probably damaging Het
Psd3 T A 8: 67,908,861 T539S probably benign Het
Rit2 A G 18: 31,316,852 V31A probably damaging Het
Rps6kc1 G A 1: 190,799,466 P780S probably benign Het
Serpina6 G T 12: 103,648,579 T336K possibly damaging Het
Smo A T 6: 29,754,467 Q232L probably benign Het
Stx2 T C 5: 128,991,091 D184G probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Other mutations in Tmprss11d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02393:Tmprss11d APN 5 86303612 makesense probably null
IGL02519:Tmprss11d APN 5 86306305 missense probably damaging 1.00
IGL02666:Tmprss11d APN 5 86331193 missense probably damaging 1.00
IGL02974:Tmprss11d APN 5 86306376 missense probably damaging 1.00
IGL03305:Tmprss11d APN 5 86326420 missense probably damaging 1.00
R0440:Tmprss11d UTSW 5 86338812 missense probably damaging 0.96
R1261:Tmprss11d UTSW 5 86309380 missense possibly damaging 0.52
R1544:Tmprss11d UTSW 5 86338799 missense probably damaging 1.00
R2018:Tmprss11d UTSW 5 86339554 missense probably damaging 0.97
R2036:Tmprss11d UTSW 5 86309269 missense probably damaging 0.97
R2267:Tmprss11d UTSW 5 86373349 missense probably benign 0.01
R4063:Tmprss11d UTSW 5 86309318 missense probably benign 0.04
R4087:Tmprss11d UTSW 5 86309279 missense probably damaging 1.00
R4665:Tmprss11d UTSW 5 86309401 missense probably damaging 1.00
R4666:Tmprss11d UTSW 5 86309401 missense probably damaging 1.00
R4784:Tmprss11d UTSW 5 86306281 missense probably damaging 0.99
R4785:Tmprss11d UTSW 5 86306281 missense probably damaging 0.99
R5077:Tmprss11d UTSW 5 86309263 critical splice donor site probably null
R5201:Tmprss11d UTSW 5 86309355 missense possibly damaging 0.92
R5523:Tmprss11d UTSW 5 86338870 missense probably benign 0.05
R5618:Tmprss11d UTSW 5 86306295 missense probably benign
R5643:Tmprss11d UTSW 5 86326529 missense probably benign 0.00
R5834:Tmprss11d UTSW 5 86306310 missense probably damaging 1.00
R6422:Tmprss11d UTSW 5 86309425 missense probably damaging 1.00
R6706:Tmprss11d UTSW 5 86331103 missense probably benign 0.03
R6735:Tmprss11d UTSW 5 86309300 missense probably damaging 1.00
R6778:Tmprss11d UTSW 5 86309350 missense probably benign 0.34
R7013:Tmprss11d UTSW 5 86326573 missense probably damaging 0.99
R7273:Tmprss11d UTSW 5 86337239 missense probably damaging 1.00
R7488:Tmprss11d UTSW 5 86326450 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCACAGATCTATCTTCTCTAAC -3'
(R):5'- AGCTTTGTCAATCTTTTGAGAACCC -3'

Sequencing Primer
(F):5'- AACACTGGTCTGCATGTGC -3'
(R):5'- TTGAGAACCCAAAAGAAAATAACTGC -3'
Posted On2016-08-04