Incidental Mutation 'R0487:Zfp641'
ID42377
Institutional Source Beutler Lab
Gene Symbol Zfp641
Ensembl Gene ENSMUSG00000022987
Gene Namezinc finger protein 641
Synonyms9930016F01Rik
MMRRC Submission 038686-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R0487 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location98285585-98296161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 98289179 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 188 (V188L)
Ref Sequence ENSEMBL: ENSMUSP00000133212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023722] [ENSMUST00000169721]
Predicted Effect probably benign
Transcript: ENSMUST00000023722
AA Change: V174L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023722
Gene: ENSMUSG00000022987
AA Change: V174L

DomainStartEndE-ValueType
KRAB 91 142 2.16e-10 SMART
ZnF_C2H2 236 258 1.58e-3 SMART
ZnF_C2H2 264 286 1.67e-2 SMART
ZnF_C2H2 292 314 1.33e-1 SMART
ZnF_C2H2 342 364 8.94e-3 SMART
ZnF_C2H2 370 392 3.83e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169721
AA Change: V188L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133212
Gene: ENSMUSG00000022987
AA Change: V188L

DomainStartEndE-ValueType
low complexity region 83 89 N/A INTRINSIC
KRAB 95 156 2.56e-21 SMART
ZnF_C2H2 250 272 1.58e-3 SMART
ZnF_C2H2 278 300 1.67e-2 SMART
ZnF_C2H2 306 328 1.33e-1 SMART
ZnF_C2H2 356 378 8.94e-3 SMART
ZnF_C2H2 384 406 3.83e-2 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,331,687 M3190L probably benign Het
Adgrv1 A T 13: 81,489,035 L3429H probably damaging Het
Ahnak A G 19: 9,007,151 N1933S probably benign Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
AI314180 A G 4: 58,819,155 V1265A probably damaging Het
Amacr A G 15: 10,984,749 D151G probably benign Het
Ano9 A T 7: 141,107,849 H255Q possibly damaging Het
Asphd2 A T 5: 112,391,635 Y111N probably damaging Het
Cage1 T A 13: 38,025,358 K214N probably benign Het
Cdkn2c A G 4: 109,661,409 L116P probably damaging Het
Cltc C T 11: 86,733,664 R148H probably damaging Het
Cmbl A G 15: 31,582,030 N58D probably damaging Het
Cpa6 T C 1: 10,409,262 T249A possibly damaging Het
Cpsf1 T A 15: 76,597,002 N1218I probably damaging Het
Csf2rb T C 15: 78,348,331 S613P probably benign Het
Ctnnd1 A G 2: 84,609,067 S761P probably damaging Het
Cxcr6 A C 9: 123,810,398 I155L probably benign Het
Fam216a A G 5: 122,370,513 probably null Het
Fgf10 T A 13: 118,781,611 probably null Het
Fgf17 T C 14: 70,638,556 T79A probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm1527 G T 3: 28,926,679 V643L probably benign Het
Gm7534 A T 4: 134,202,778 L72Q probably damaging Het
Hmcn2 A T 2: 31,386,677 Q1556L possibly damaging Het
Hrasls G A 16: 29,220,579 probably null Het
Hspa4l C T 3: 40,784,326 T616I possibly damaging Het
Irgm1 T C 11: 48,866,327 D219G probably damaging Het
Jcad A G 18: 4,673,243 D335G probably damaging Het
Kcnh4 A G 11: 100,750,258 F455S probably damaging Het
Khdrbs3 T C 15: 69,017,361 Y120H probably damaging Het
Kndc1 A T 7: 139,914,023 T507S probably null Het
Lepr G T 4: 101,768,093 E482* probably null Het
Lrmp A G 6: 145,165,260 S264G probably benign Het
Mcemp1 T A 8: 3,667,507 M146K probably benign Het
Mllt10 A G 2: 18,207,137 T411A probably damaging Het
Myh8 A T 11: 67,302,011 I1543L probably benign Het
Myo1f T C 17: 33,578,284 S147P probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Olfr1106 C T 2: 87,048,493 V248I probably damaging Het
Plch2 G A 4: 155,009,012 R57C probably damaging Het
Rbm20 G A 19: 53,851,195 G872R probably damaging Het
Retsat A T 6: 72,606,431 I373F probably damaging Het
Rnf145 T C 11: 44,555,229 F297L probably benign Het
Ros1 A T 10: 52,155,108 M479K possibly damaging Het
Rubcnl T A 14: 75,036,081 N244K probably benign Het
Samhd1 A G 2: 157,110,615 F406L probably damaging Het
Sdsl A T 5: 120,459,468 V258D probably damaging Het
Sec24c C G 14: 20,683,399 P166A probably benign Het
Sele C A 1: 164,053,615 Y461* probably null Het
Slc22a1 G T 17: 12,662,600 S334* probably null Het
Spem1 T G 11: 69,821,865 probably null Het
Stat3 T C 11: 100,903,643 E280G probably damaging Het
Stxbp4 T C 11: 90,592,360 H280R probably benign Het
Tas2r129 G A 6: 132,951,943 C281Y probably benign Het
Tas2r129 T G 6: 132,951,944 C281W probably benign Het
Tcp11 T A 17: 28,079,923 probably null Het
Tnrc6b G A 15: 80,880,675 V793M probably benign Het
Vmn2r59 A C 7: 42,047,104 Y71* probably null Het
Wdr35 T C 12: 9,012,743 probably null Het
Zan A G 5: 137,413,358 probably null Het
Zap70 G T 1: 36,779,284 V351L probably damaging Het
Zfp609 G T 9: 65,702,634 Q1016K unknown Het
Other mutations in Zfp641
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Zfp641 APN 15 98291185 missense possibly damaging 0.85
IGL03092:Zfp641 APN 15 98290516 missense probably damaging 1.00
IGL03191:Zfp641 APN 15 98288687 missense probably damaging 0.98
R0079:Zfp641 UTSW 15 98289089 missense probably benign 0.28
R0243:Zfp641 UTSW 15 98289127 missense possibly damaging 0.82
R2092:Zfp641 UTSW 15 98293712 missense probably benign
R3415:Zfp641 UTSW 15 98290540 missense probably benign 0.28
R4834:Zfp641 UTSW 15 98293704 missense probably damaging 1.00
R4851:Zfp641 UTSW 15 98288717 missense probably damaging 0.99
R5776:Zfp641 UTSW 15 98289010 missense probably damaging 1.00
R6057:Zfp641 UTSW 15 98292935 missense probably benign 0.00
R6896:Zfp641 UTSW 15 98293803 start codon destroyed probably benign 0.06
R6958:Zfp641 UTSW 15 98292951 missense possibly damaging 0.46
R6969:Zfp641 UTSW 15 98290567 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- ATCGGAAACTCTTGCCGCACTC -3'
(R):5'- AGCCCCTCTGGGCTAACATTTGTC -3'

Sequencing Primer
(F):5'- CAAACTGTTTCCCACATTGAGG -3'
(R):5'- GGCTAACATTTGTCATCAGGC -3'
Posted On2013-05-23