Incidental Mutation 'R0487:Slc22a1'
ID42379
Institutional Source Beutler Lab
Gene Symbol Slc22a1
Ensembl Gene ENSMUSG00000023829
Gene Namesolute carrier family 22 (organic cation transporter), member 1
SynonymsLx1, Oct1, Oct1, Orct1, Orct
MMRRC Submission 038686-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0487 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location12648874-12675838 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 12662600 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 334 (S334*)
Ref Sequence ENSEMBL: ENSMUSP00000024596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024596]
Predicted Effect probably null
Transcript: ENSMUST00000024596
AA Change: S334*
SMART Domains Protein: ENSMUSP00000024596
Gene: ENSMUSG00000023829
AA Change: S334*

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:MFS_1 134 482 1.3e-25 PFAM
Pfam:Sugar_tr 143 529 5.3e-33 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. This gene is one of three similar cation transporter genes located in a cluster on chromosome 6. The encoded protein contains twelve putative transmembrane domains and is a plasma integral membrane protein. Two transcript variants encoding two different isoforms have been found for this gene, but only the longer variant encodes a functional transporter. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knockout allele are viable, healthy, and fertile but exhibit an impaired liver uptake and direct intestinal excretion of substrate organic cations. Mice homozygous for a different knockout allele show alterations in metformin disposition and its glucose-lowering effects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,331,687 M3190L probably benign Het
Adgrv1 A T 13: 81,489,035 L3429H probably damaging Het
Ahnak A G 19: 9,007,151 N1933S probably benign Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
AI314180 A G 4: 58,819,155 V1265A probably damaging Het
Amacr A G 15: 10,984,749 D151G probably benign Het
Ano9 A T 7: 141,107,849 H255Q possibly damaging Het
Asphd2 A T 5: 112,391,635 Y111N probably damaging Het
Cage1 T A 13: 38,025,358 K214N probably benign Het
Cdkn2c A G 4: 109,661,409 L116P probably damaging Het
Cltc C T 11: 86,733,664 R148H probably damaging Het
Cmbl A G 15: 31,582,030 N58D probably damaging Het
Cpa6 T C 1: 10,409,262 T249A possibly damaging Het
Cpsf1 T A 15: 76,597,002 N1218I probably damaging Het
Csf2rb T C 15: 78,348,331 S613P probably benign Het
Ctnnd1 A G 2: 84,609,067 S761P probably damaging Het
Cxcr6 A C 9: 123,810,398 I155L probably benign Het
Fam216a A G 5: 122,370,513 probably null Het
Fgf10 T A 13: 118,781,611 probably null Het
Fgf17 T C 14: 70,638,556 T79A probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm1527 G T 3: 28,926,679 V643L probably benign Het
Gm7534 A T 4: 134,202,778 L72Q probably damaging Het
Hmcn2 A T 2: 31,386,677 Q1556L possibly damaging Het
Hrasls G A 16: 29,220,579 probably null Het
Hspa4l C T 3: 40,784,326 T616I possibly damaging Het
Irgm1 T C 11: 48,866,327 D219G probably damaging Het
Jcad A G 18: 4,673,243 D335G probably damaging Het
Kcnh4 A G 11: 100,750,258 F455S probably damaging Het
Khdrbs3 T C 15: 69,017,361 Y120H probably damaging Het
Kndc1 A T 7: 139,914,023 T507S probably null Het
Lepr G T 4: 101,768,093 E482* probably null Het
Lrmp A G 6: 145,165,260 S264G probably benign Het
Mcemp1 T A 8: 3,667,507 M146K probably benign Het
Mllt10 A G 2: 18,207,137 T411A probably damaging Het
Myh8 A T 11: 67,302,011 I1543L probably benign Het
Myo1f T C 17: 33,578,284 S147P probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Olfr1106 C T 2: 87,048,493 V248I probably damaging Het
Plch2 G A 4: 155,009,012 R57C probably damaging Het
Rbm20 G A 19: 53,851,195 G872R probably damaging Het
Retsat A T 6: 72,606,431 I373F probably damaging Het
Rnf145 T C 11: 44,555,229 F297L probably benign Het
Ros1 A T 10: 52,155,108 M479K possibly damaging Het
Rubcnl T A 14: 75,036,081 N244K probably benign Het
Samhd1 A G 2: 157,110,615 F406L probably damaging Het
Sdsl A T 5: 120,459,468 V258D probably damaging Het
Sec24c C G 14: 20,683,399 P166A probably benign Het
Sele C A 1: 164,053,615 Y461* probably null Het
Spem1 T G 11: 69,821,865 probably null Het
Stat3 T C 11: 100,903,643 E280G probably damaging Het
Stxbp4 T C 11: 90,592,360 H280R probably benign Het
Tas2r129 G A 6: 132,951,943 C281Y probably benign Het
Tas2r129 T G 6: 132,951,944 C281W probably benign Het
Tcp11 T A 17: 28,079,923 probably null Het
Tnrc6b G A 15: 80,880,675 V793M probably benign Het
Vmn2r59 A C 7: 42,047,104 Y71* probably null Het
Wdr35 T C 12: 9,012,743 probably null Het
Zan A G 5: 137,413,358 probably null Het
Zap70 G T 1: 36,779,284 V351L probably damaging Het
Zfp609 G T 9: 65,702,634 Q1016K unknown Het
Zfp641 C A 15: 98,289,179 V188L probably benign Het
Other mutations in Slc22a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Slc22a1 APN 17 12650862 splice site probably benign
IGL02313:Slc22a1 APN 17 12675500 nonsense probably null
IGL02578:Slc22a1 APN 17 12667239 missense probably damaging 1.00
R0017:Slc22a1 UTSW 17 12659759 missense probably damaging 1.00
R0136:Slc22a1 UTSW 17 12662596 missense probably benign 0.03
R0306:Slc22a1 UTSW 17 12662598 missense probably benign 0.03
R0408:Slc22a1 UTSW 17 12656941 missense probably damaging 1.00
R0654:Slc22a1 UTSW 17 12662792 missense probably damaging 1.00
R0811:Slc22a1 UTSW 17 12666618 splice site probably benign
R0866:Slc22a1 UTSW 17 12657046 missense probably benign 0.00
R1414:Slc22a1 UTSW 17 12662600 missense probably damaging 1.00
R1490:Slc22a1 UTSW 17 12662893 splice site probably null
R4801:Slc22a1 UTSW 17 12675535 missense probably damaging 1.00
R4802:Slc22a1 UTSW 17 12675535 missense probably damaging 1.00
R5101:Slc22a1 UTSW 17 12667242 missense probably damaging 1.00
R5147:Slc22a1 UTSW 17 12650951 missense probably damaging 1.00
R6816:Slc22a1 UTSW 17 12652483 missense possibly damaging 0.83
R6875:Slc22a1 UTSW 17 12667305 nonsense probably null
R7263:Slc22a1 UTSW 17 12666700 missense probably damaging 1.00
R7295:Slc22a1 UTSW 17 12657005 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TTCTGAAGACTCAGGCGTCAGGAC -3'
(R):5'- AGCCATGCATCGAACGGATCAC -3'

Sequencing Primer
(F):5'- CGTCAGGACTGTGCTGAG -3'
(R):5'- TCGAACGGATCACTCTTGCTAAG -3'
Posted On2013-05-23