Incidental Mutation 'R5351:Prkar2b'
ID 423809
Institutional Source Beutler Lab
Gene Symbol Prkar2b
Ensembl Gene ENSMUSG00000002997
Gene Name protein kinase, cAMP dependent regulatory, type II beta
Synonyms RII(beta), Pkarb2, PKARIIbeta
MMRRC Submission 042930-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.329) question?
Stock # R5351 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 32008475-32111295 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 32022126 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 60 (G60R)
Ref Sequence ENSEMBL: ENSMUSP00000135290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003079] [ENSMUST00000036497] [ENSMUST00000146865]
AlphaFold P31324
Predicted Effect probably damaging
Transcript: ENSMUST00000003079
AA Change: G220R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003079
Gene: ENSMUSG00000002997
AA Change: G220R

DomainStartEndE-ValueType
RIIa 7 44 7.78e-17 SMART
low complexity region 61 68 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
cNMP 152 272 7.2e-26 SMART
cNMP 274 398 8.53e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000036497
AA Change: G220R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039797
Gene: ENSMUSG00000002997
AA Change: G220R

DomainStartEndE-ValueType
RIIa 7 44 7.78e-17 SMART
low complexity region 61 68 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
cNMP 152 272 7.2e-26 SMART
cNMP 274 398 8.53e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000146865
AA Change: G60R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135290
Gene: ENSMUSG00000002997
AA Change: G60R

DomainStartEndE-ValueType
cNMP 1 112 1.33e-15 SMART
cNMP 114 238 8.53e-28 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is one of the regulatory subunits. This subunit can be phosphorylated by the activated catalytic subunit. This subunit has been shown to interact with and suppress the transcriptional activity of the cAMP responsive element binding protein 1 (CREB1) in activated T cells. Knockout studies in mice suggest that this subunit may play an important role in regulating energy balance and adiposity. The studies also suggest that this subunit may mediate the gene induction and cataleptic behavior induced by haloperidol. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygou null mice are lean, weigh less than controls, and have reduced white fat pad size. Mice are resistant to both diet-induced obesity and to diet-induced insulin resistance. Mice show impaired coordination and increased sensitivity to chronic amphetamine exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 T A 3: 127,522,941 (GRCm39) S34C probably damaging Het
Apol7e T G 15: 77,602,511 (GRCm39) *370G probably null Het
Cacna2d4 T C 6: 119,245,162 (GRCm39) I290T probably damaging Het
Ceacam12 T A 7: 17,801,159 (GRCm39) V46D probably damaging Het
Ces1d A G 8: 93,904,706 (GRCm39) Y345H probably damaging Het
Cirbp T C 10: 80,006,136 (GRCm39) probably benign Het
Cnot8 T A 11: 58,006,147 (GRCm39) H225Q probably damaging Het
Fstl1 T C 16: 37,649,542 (GRCm39) V252A probably damaging Het
H2-T3 T C 17: 36,500,965 (GRCm39) Q17R probably benign Het
Htt A G 5: 34,961,177 (GRCm39) Y268C probably damaging Het
Ildr2 T C 1: 166,136,478 (GRCm39) V439A possibly damaging Het
Lig1 T C 7: 13,034,875 (GRCm39) M557T probably damaging Het
Ltbp2 T C 12: 84,837,132 (GRCm39) E1229G possibly damaging Het
Mynn C T 3: 30,661,691 (GRCm39) R258W probably benign Het
Nbas T A 12: 13,610,850 (GRCm39) N2180K probably damaging Het
Or8j3c A G 2: 86,253,610 (GRCm39) S137P probably damaging Het
Pcdh1 C T 18: 38,330,819 (GRCm39) G728D probably damaging Het
Pfas T C 11: 68,882,217 (GRCm39) D882G probably damaging Het
Prkdc G C 16: 15,649,176 (GRCm39) V3717L probably benign Het
Prom1 A T 5: 44,201,697 (GRCm39) V250E probably damaging Het
Slc35d1 A G 4: 103,047,036 (GRCm39) L254P probably damaging Het
Srrt T C 5: 137,296,546 (GRCm39) *239W probably null Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Ttn T A 2: 76,585,168 (GRCm39) I22042F probably damaging Het
Ttn A G 2: 76,773,385 (GRCm39) V2339A probably damaging Het
Unc80 T A 1: 66,645,672 (GRCm39) S1449R possibly damaging Het
Vmn2r24 A T 6: 123,793,223 (GRCm39) K850M possibly damaging Het
Zfp516 A G 18: 82,974,876 (GRCm39) E358G probably benign Het
Other mutations in Prkar2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01549:Prkar2b APN 12 32,111,071 (GRCm39) missense possibly damaging 0.55
IGL02056:Prkar2b APN 12 32,025,909 (GRCm39) splice site probably benign
IGL02071:Prkar2b APN 12 32,013,016 (GRCm39) missense probably damaging 1.00
IGL02118:Prkar2b APN 12 32,025,963 (GRCm39) missense probably damaging 1.00
spark UTSW 12 32,037,973 (GRCm39) splice site probably null
R0211:Prkar2b UTSW 12 32,022,183 (GRCm39) missense probably benign 0.30
R0362:Prkar2b UTSW 12 32,037,973 (GRCm39) splice site probably null
R0485:Prkar2b UTSW 12 32,026,034 (GRCm39) splice site probably benign
R0898:Prkar2b UTSW 12 32,013,001 (GRCm39) missense possibly damaging 0.90
R1426:Prkar2b UTSW 12 32,012,987 (GRCm39) splice site probably benign
R1997:Prkar2b UTSW 12 32,013,934 (GRCm39) missense probably damaging 0.99
R2114:Prkar2b UTSW 12 32,017,279 (GRCm39) missense probably damaging 1.00
R2346:Prkar2b UTSW 12 32,022,149 (GRCm39) missense probably benign 0.01
R2513:Prkar2b UTSW 12 32,025,928 (GRCm39) missense possibly damaging 0.93
R3875:Prkar2b UTSW 12 32,015,122 (GRCm39) missense probably benign 0.01
R5301:Prkar2b UTSW 12 32,025,927 (GRCm39) missense probably damaging 1.00
R5316:Prkar2b UTSW 12 32,110,984 (GRCm39) missense probably damaging 0.97
R6025:Prkar2b UTSW 12 32,110,855 (GRCm39) missense possibly damaging 0.68
R6028:Prkar2b UTSW 12 32,043,757 (GRCm39) missense possibly damaging 0.50
R6563:Prkar2b UTSW 12 32,043,785 (GRCm39) splice site probably null
R7074:Prkar2b UTSW 12 32,022,147 (GRCm39) missense probably damaging 1.00
R7431:Prkar2b UTSW 12 32,013,150 (GRCm39) splice site probably null
R7747:Prkar2b UTSW 12 32,110,937 (GRCm39) missense probably benign 0.23
R7978:Prkar2b UTSW 12 32,013,024 (GRCm39) missense possibly damaging 0.81
R8926:Prkar2b UTSW 12 32,111,080 (GRCm39) start codon destroyed probably null 0.99
R9102:Prkar2b UTSW 12 32,013,025 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGAATGCCAATGACTTGTG -3'
(R):5'- TCAAGATTGCATTGCACGGGG -3'

Sequencing Primer
(F):5'- GAATGCCAATGACTTGTGATCCC -3'
(R):5'- ACGGGGCTCTTCTCTGAAG -3'
Posted On 2016-08-04