Incidental Mutation 'R5351:Apol7e'
List |< first << previous [record 57 of 958] next >> last >|
ID423812
Institutional Source Beutler Lab
Gene Symbol Apol7e
Ensembl Gene ENSMUSG00000071716
Gene Nameapolipoprotein L 7e
SynonymsENSMUSG00000071716
MMRRC Submission 042930-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5351 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location77698857-77719285 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to G at 77718311 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glycine at position 370 (*370G)
Ref Sequence ENSEMBL: ENSMUSP00000094085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096358]
Predicted Effect probably null
Transcript: ENSMUST00000096358
AA Change: *370G
SMART Domains Protein: ENSMUSP00000094085
Gene: ENSMUSG00000071716
AA Change: *370G

DomainStartEndE-ValueType
Pfam:ApoL 20 82 2.3e-14 PFAM
Pfam:ApoL 77 367 6.9e-121 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230236
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 T A 3: 127,729,292 S34C probably damaging Het
Cacna2d4 T C 6: 119,268,201 I290T probably damaging Het
Ceacam12 T A 7: 18,067,234 V46D probably damaging Het
Ces1d A G 8: 93,178,078 Y345H probably damaging Het
Cirbp T C 10: 80,170,302 probably benign Het
Cnot8 T A 11: 58,115,321 H225Q probably damaging Het
Fstl1 T C 16: 37,829,180 V252A probably damaging Het
H2-T3 T C 17: 36,190,073 Q17R probably benign Het
Htt A G 5: 34,803,833 Y268C probably damaging Het
Ildr2 T C 1: 166,308,909 V439A possibly damaging Het
Lig1 T C 7: 13,300,949 M557T probably damaging Het
Ltbp2 T C 12: 84,790,358 E1229G possibly damaging Het
Mynn C T 3: 30,607,542 R258W probably benign Het
Nbas T A 12: 13,560,849 N2180K probably damaging Het
Olfr1062 A G 2: 86,423,266 S137P probably damaging Het
Pcdh1 C T 18: 38,197,766 G728D probably damaging Het
Pfas T C 11: 68,991,391 D882G probably damaging Het
Prkar2b C T 12: 31,972,127 G60R probably damaging Het
Prkdc G C 16: 15,831,312 V3717L probably benign Het
Prom1 A T 5: 44,044,355 V250E probably damaging Het
Slc35d1 A G 4: 103,189,839 L254P probably damaging Het
Srrt T C 5: 137,298,284 *239W probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ttn A G 2: 76,943,041 V2339A probably damaging Het
Unc80 T A 1: 66,606,513 S1449R possibly damaging Het
Vmn2r24 A T 6: 123,816,264 K850M possibly damaging Het
Zfp516 A G 18: 82,956,751 E358G probably benign Het
Other mutations in Apol7e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02110:Apol7e APN 15 77714348 critical splice acceptor site probably null
R0864:Apol7e UTSW 15 77717793 missense probably damaging 1.00
R1467:Apol7e UTSW 15 77717766 missense probably damaging 1.00
R1467:Apol7e UTSW 15 77717766 missense probably damaging 1.00
R1585:Apol7e UTSW 15 77717829 missense probably damaging 0.99
R1897:Apol7e UTSW 15 77717894 missense probably benign
R2047:Apol7e UTSW 15 77717610 missense probably benign 0.06
R2311:Apol7e UTSW 15 77718036 missense probably benign 0.14
R2895:Apol7e UTSW 15 77714467 missense possibly damaging 0.65
R3809:Apol7e UTSW 15 77718062 missense probably benign 0.05
R3842:Apol7e UTSW 15 77717589 missense probably damaging 1.00
R5629:Apol7e UTSW 15 77718076 missense probably benign 0.08
R5853:Apol7e UTSW 15 77714467 missense probably benign
R5882:Apol7e UTSW 15 77718247 missense probably benign
R6337:Apol7e UTSW 15 77714382 missense possibly damaging 0.80
R6826:Apol7e UTSW 15 77718291 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGCAATGACCAAAGGAGCC -3'
(R):5'- ATAGCTCTGAATGAGTCATAGGC -3'

Sequencing Primer
(F):5'- CCAAAGGAGCCCGGATCATG -3'
(R):5'- CTCTGAATGAGTCATAGGCAAAAG -3'
Posted On2016-08-04