Incidental Mutation 'R5352:Rp1'
ID 423820
Institutional Source Beutler Lab
Gene Symbol Rp1
Ensembl Gene ENSMUSG00000025900
Gene Name retinitis pigmentosa 1 (human)
Synonyms Dcdc3, Orp1, mG145, Rp1h, oxygen-regulated protein 1
MMRRC Submission 042931-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R5352 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 4185896-4479508 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 4417321 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 1264 (S1264G)
Ref Sequence ENSEMBL: ENSMUSP00000027032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027032] [ENSMUST00000194992] [ENSMUST00000208660]
AlphaFold P56716
Predicted Effect probably benign
Transcript: ENSMUST00000027032
AA Change: S1264G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027032
Gene: ENSMUSG00000025900
AA Change: S1264G

DomainStartEndE-ValueType
DCX 30 117 4.37e-39 SMART
low complexity region 120 133 N/A INTRINSIC
DCX 152 236 7.17e-35 SMART
low complexity region 343 354 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
low complexity region 646 661 N/A INTRINSIC
low complexity region 1113 1123 N/A INTRINSIC
low complexity region 1396 1412 N/A INTRINSIC
low complexity region 1434 1444 N/A INTRINSIC
low complexity region 1648 1661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194992
SMART Domains Protein: ENSMUSP00000142146
Gene: ENSMUSG00000025900

DomainStartEndE-ValueType
DCX 40 127 4.37e-39 SMART
low complexity region 130 143 N/A INTRINSIC
DCX 162 246 7.17e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208793
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Two transcript variants encoding distinct isoforms are resulted from alternative promoters and alternative splicing. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience progressive degeneration in photoreceptors but are otherwise phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T G 16: 14,436,565 (GRCm39) L206* probably null Het
Adgrv1 T C 13: 81,642,776 (GRCm39) Y3218C probably damaging Het
Agtpbp1 G A 13: 59,621,560 (GRCm39) T41M probably damaging Het
Akap6 A T 12: 52,842,880 (GRCm39) E76V probably damaging Het
Ank2 C A 3: 127,292,640 (GRCm39) probably benign Het
Atp6ap1l A C 13: 91,031,875 (GRCm39) L269R probably damaging Het
Blk A G 14: 63,613,420 (GRCm39) S363P probably damaging Het
Bltp3a G A 17: 28,106,489 (GRCm39) S1005N probably benign Het
Btnl9 T C 11: 49,069,667 (GRCm39) N204S probably benign Het
Cc2d2a G T 5: 43,863,555 (GRCm39) W672C probably damaging Het
Ccnf A G 17: 24,462,247 (GRCm39) probably null Het
Cdc45 C T 16: 18,614,647 (GRCm39) R205H probably damaging Het
Chst1 A G 2: 92,443,710 (GRCm39) T61A possibly damaging Het
Col6a4 G A 9: 105,938,743 (GRCm39) T1325I probably damaging Het
Col7a1 A C 9: 108,790,479 (GRCm39) T976P unknown Het
Corin C T 5: 72,462,376 (GRCm39) S811N probably benign Het
Dnal1 T C 12: 84,183,322 (GRCm39) V27A possibly damaging Het
Dusp29 G A 14: 21,727,091 (GRCm39) R186W probably benign Het
F830045P16Rik T A 2: 129,314,821 (GRCm39) H152L probably damaging Het
Flnc A G 6: 29,449,317 (GRCm39) S1405G possibly damaging Het
Foxj1 T C 11: 116,224,905 (GRCm39) N154S possibly damaging Het
Gm12183 T C 11: 48,642,989 (GRCm39) noncoding transcript Het
Gm27047 G A 6: 130,607,982 (GRCm39) noncoding transcript Het
Grm5 A G 7: 87,724,058 (GRCm39) I783V probably damaging Het
Hk1 A T 10: 62,140,549 (GRCm39) S113T probably damaging Het
Iqca1 A T 1: 90,057,918 (GRCm39) N260K probably benign Het
Iws1 A T 18: 32,216,457 (GRCm39) K399M probably damaging Het
Kdm4d A G 9: 14,375,654 (GRCm39) I68T probably damaging Het
Man2a1 T C 17: 65,038,241 (GRCm39) I75T probably damaging Het
Med13 T A 11: 86,192,294 (GRCm39) I824L possibly damaging Het
Meioc A T 11: 102,566,139 (GRCm39) E585V probably benign Het
Mrgpre A C 7: 143,334,831 (GRCm39) F224C probably damaging Het
Muc5b T A 7: 141,418,295 (GRCm39) F3747Y possibly damaging Het
Nherf2 C T 17: 24,861,229 (GRCm39) R66H probably damaging Het
Nlrp4e T C 7: 23,052,598 (GRCm39) V839A probably benign Het
Nup210 A T 6: 91,046,298 (GRCm39) V545E probably damaging Het
Ola1 T C 2: 72,929,674 (GRCm39) T310A probably damaging Het
Pdxdc1 T C 16: 13,658,175 (GRCm39) N516S probably benign Het
Phlpp1 A G 1: 106,100,455 (GRCm39) D241G probably benign Het
Ppp1r36 T C 12: 76,474,857 (GRCm39) V85A probably damaging Het
Rasa3 A C 8: 13,681,778 (GRCm39) L57R possibly damaging Het
Rprd1b A G 2: 157,900,656 (GRCm39) E247G probably damaging Het
Sag G T 1: 87,740,715 (GRCm39) V46L probably benign Het
Sat2 A T 11: 69,513,141 (GRCm39) I17F probably damaging Het
Slc39a6 A T 18: 24,734,093 (GRCm39) Y199N probably benign Het
Snx2 A G 18: 53,330,997 (GRCm39) probably null Het
Thbs4 T C 13: 92,900,098 (GRCm39) D466G probably damaging Het
Tmem208 A G 8: 106,055,063 (GRCm39) D91G probably damaging Het
Tmf1 A G 6: 97,153,770 (GRCm39) L101P probably damaging Het
Tnni1 A G 1: 135,733,330 (GRCm39) T51A probably benign Het
Tor3a T G 1: 156,501,763 (GRCm39) E38A probably damaging Het
Trim31 T A 17: 37,210,810 (GRCm39) D147E possibly damaging Het
Vmn1r48 G T 6: 90,013,129 (GRCm39) A232E probably benign Het
Vmn1r89 T G 7: 12,953,284 (GRCm39) F7V probably benign Het
Zfp160 A G 17: 21,247,114 (GRCm39) T555A probably benign Het
Zfp981 C A 4: 146,621,462 (GRCm39) T129K probably benign Het
Zfpm2 T A 15: 40,733,938 (GRCm39) F106I probably benign Het
Other mutations in Rp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Rp1 APN 1 4,416,969 (GRCm39) missense probably damaging 0.98
IGL00593:Rp1 APN 1 4,415,626 (GRCm39) missense possibly damaging 0.70
IGL00956:Rp1 APN 1 4,422,435 (GRCm39) missense probably damaging 1.00
IGL01070:Rp1 APN 1 4,415,461 (GRCm39) missense probably damaging 1.00
IGL01531:Rp1 APN 1 4,419,168 (GRCm39) missense probably benign 0.00
IGL01668:Rp1 APN 1 4,415,941 (GRCm39) missense probably damaging 1.00
IGL01907:Rp1 APN 1 4,418,730 (GRCm39) missense possibly damaging 0.56
IGL02055:Rp1 APN 1 4,422,745 (GRCm39) missense probably damaging 1.00
IGL02071:Rp1 APN 1 4,415,533 (GRCm39) missense possibly damaging 0.46
IGL02128:Rp1 APN 1 4,417,608 (GRCm39) missense probably damaging 0.99
IGL02244:Rp1 APN 1 4,419,003 (GRCm39) missense probably benign 0.00
IGL02381:Rp1 APN 1 4,422,613 (GRCm39) missense probably benign 0.01
IGL02499:Rp1 APN 1 4,419,271 (GRCm39) missense probably benign 0.17
IGL02619:Rp1 APN 1 4,418,673 (GRCm39) missense possibly damaging 0.73
IGL02832:Rp1 APN 1 4,419,936 (GRCm39) missense probably benign 0.03
IGL02861:Rp1 APN 1 4,416,375 (GRCm39) nonsense probably null
IGL03288:Rp1 APN 1 4,419,747 (GRCm39) missense possibly damaging 0.88
IGL03290:Rp1 APN 1 4,420,264 (GRCm39) missense probably damaging 1.00
IGL03303:Rp1 APN 1 4,415,040 (GRCm39) missense probably damaging 1.00
R0041:Rp1 UTSW 1 4,414,851 (GRCm39) missense probably benign 0.36
R0111:Rp1 UTSW 1 4,414,983 (GRCm39) missense probably damaging 1.00
R0363:Rp1 UTSW 1 4,417,941 (GRCm39) missense probably damaging 1.00
R0440:Rp1 UTSW 1 4,415,863 (GRCm39) missense probably damaging 1.00
R0442:Rp1 UTSW 1 4,416,970 (GRCm39) missense probably benign 0.09
R0528:Rp1 UTSW 1 4,415,088 (GRCm39) missense possibly damaging 0.82
R0586:Rp1 UTSW 1 4,418,060 (GRCm39) missense possibly damaging 0.76
R0639:Rp1 UTSW 1 4,416,721 (GRCm39) missense probably benign 0.00
R0856:Rp1 UTSW 1 4,414,878 (GRCm39) missense probably benign 0.05
R0908:Rp1 UTSW 1 4,414,878 (GRCm39) missense probably benign 0.05
R0968:Rp1 UTSW 1 4,415,575 (GRCm39) missense probably benign 0.00
R1099:Rp1 UTSW 1 4,422,513 (GRCm39) missense possibly damaging 0.45
R1242:Rp1 UTSW 1 4,415,185 (GRCm39) missense probably benign 0.03
R1301:Rp1 UTSW 1 4,416,159 (GRCm39) missense possibly damaging 0.56
R1327:Rp1 UTSW 1 4,418,193 (GRCm39) missense probably benign 0.01
R1403:Rp1 UTSW 1 4,416,520 (GRCm39) missense possibly damaging 0.73
R1403:Rp1 UTSW 1 4,416,520 (GRCm39) missense possibly damaging 0.73
R1406:Rp1 UTSW 1 4,422,144 (GRCm39) missense possibly damaging 0.88
R1406:Rp1 UTSW 1 4,422,144 (GRCm39) missense possibly damaging 0.88
R1440:Rp1 UTSW 1 4,417,619 (GRCm39) missense probably damaging 1.00
R1509:Rp1 UTSW 1 4,418,760 (GRCm39) missense probably benign 0.20
R1509:Rp1 UTSW 1 4,417,917 (GRCm39) missense probably damaging 0.98
R1538:Rp1 UTSW 1 4,415,899 (GRCm39) missense probably damaging 1.00
R1609:Rp1 UTSW 1 4,419,424 (GRCm39) missense probably damaging 1.00
R1666:Rp1 UTSW 1 4,420,086 (GRCm39) missense probably damaging 1.00
R1703:Rp1 UTSW 1 4,415,392 (GRCm39) missense probably damaging 1.00
R1782:Rp1 UTSW 1 4,419,312 (GRCm39) missense probably benign 0.00
R1799:Rp1 UTSW 1 4,419,055 (GRCm39) missense possibly damaging 0.94
R1848:Rp1 UTSW 1 4,417,455 (GRCm39) missense possibly damaging 0.76
R1908:Rp1 UTSW 1 4,418,943 (GRCm39) missense probably damaging 0.99
R1919:Rp1 UTSW 1 4,422,894 (GRCm39) missense probably damaging 0.99
R2087:Rp1 UTSW 1 4,418,575 (GRCm39) missense probably damaging 1.00
R2211:Rp1 UTSW 1 4,418,362 (GRCm39) missense probably damaging 0.96
R2278:Rp1 UTSW 1 4,418,250 (GRCm39) missense possibly damaging 0.51
R2287:Rp1 UTSW 1 4,416,182 (GRCm39) nonsense probably null
R2316:Rp1 UTSW 1 4,415,863 (GRCm39) missense probably damaging 1.00
R2346:Rp1 UTSW 1 4,418,236 (GRCm39) missense probably damaging 1.00
R2878:Rp1 UTSW 1 4,418,362 (GRCm39) missense probably damaging 1.00
R3023:Rp1 UTSW 1 4,422,898 (GRCm39) missense probably damaging 1.00
R3025:Rp1 UTSW 1 4,422,898 (GRCm39) missense probably damaging 1.00
R3716:Rp1 UTSW 1 4,419,988 (GRCm39) missense probably benign 0.38
R3814:Rp1 UTSW 1 4,419,931 (GRCm39) missense probably benign
R3929:Rp1 UTSW 1 4,422,868 (GRCm39) missense probably damaging 1.00
R4064:Rp1 UTSW 1 4,415,623 (GRCm39) missense probably benign 0.08
R4426:Rp1 UTSW 1 4,418,147 (GRCm39) missense probably benign 0.13
R4557:Rp1 UTSW 1 4,414,886 (GRCm39) missense possibly damaging 0.61
R4764:Rp1 UTSW 1 4,416,101 (GRCm39) missense probably damaging 0.96
R4845:Rp1 UTSW 1 4,419,451 (GRCm39) missense probably benign 0.02
R4850:Rp1 UTSW 1 4,418,898 (GRCm39) missense probably damaging 1.00
R4857:Rp1 UTSW 1 4,422,540 (GRCm39) missense probably damaging 1.00
R4857:Rp1 UTSW 1 4,422,539 (GRCm39) missense probably damaging 0.99
R5159:Rp1 UTSW 1 4,416,426 (GRCm39) missense possibly damaging 0.73
R5226:Rp1 UTSW 1 4,418,256 (GRCm39) missense probably benign 0.01
R5327:Rp1 UTSW 1 4,419,583 (GRCm39) splice site probably null
R5504:Rp1 UTSW 1 4,420,113 (GRCm39) missense probably damaging 1.00
R5527:Rp1 UTSW 1 4,416,616 (GRCm39) missense possibly damaging 0.75
R5529:Rp1 UTSW 1 4,416,055 (GRCm39) missense probably benign 0.42
R5569:Rp1 UTSW 1 4,415,460 (GRCm39) missense probably damaging 1.00
R5622:Rp1 UTSW 1 4,418,060 (GRCm39) missense possibly damaging 0.76
R5970:Rp1 UTSW 1 4,418,685 (GRCm39) missense probably benign 0.05
R5992:Rp1 UTSW 1 4,218,926 (GRCm39) missense unknown
R6004:Rp1 UTSW 1 4,267,808 (GRCm39) missense unknown
R6018:Rp1 UTSW 1 4,423,059 (GRCm39) missense possibly damaging 0.83
R6074:Rp1 UTSW 1 4,415,602 (GRCm39) missense probably benign 0.02
R6127:Rp1 UTSW 1 4,419,534 (GRCm39) missense possibly damaging 0.80
R6187:Rp1 UTSW 1 4,420,092 (GRCm39) missense probably damaging 1.00
R6301:Rp1 UTSW 1 4,417,477 (GRCm39) missense probably benign 0.04
R6317:Rp1 UTSW 1 4,112,212 (GRCm39) missense unknown
R6405:Rp1 UTSW 1 4,415,994 (GRCm39) missense probably damaging 1.00
R6445:Rp1 UTSW 1 4,296,840 (GRCm39) missense unknown
R6466:Rp1 UTSW 1 4,418,109 (GRCm39) missense probably benign 0.01
R6501:Rp1 UTSW 1 4,381,503 (GRCm39) intron probably benign
R6547:Rp1 UTSW 1 4,240,528 (GRCm39) missense unknown
R6604:Rp1 UTSW 1 4,089,351 (GRCm39) missense unknown
R6700:Rp1 UTSW 1 4,420,119 (GRCm39) missense probably damaging 1.00
R6706:Rp1 UTSW 1 4,212,887 (GRCm39) missense unknown
R6831:Rp1 UTSW 1 4,420,087 (GRCm39) splice site probably null
R6918:Rp1 UTSW 1 4,069,831 (GRCm39) missense unknown
R6973:Rp1 UTSW 1 4,422,217 (GRCm39) nonsense probably null
R6981:Rp1 UTSW 1 4,415,878 (GRCm39) missense probably benign 0.06
R7009:Rp1 UTSW 1 4,112,291 (GRCm39) missense unknown
R7078:Rp1 UTSW 1 4,277,014 (GRCm39) missense unknown
R7112:Rp1 UTSW 1 4,419,241 (GRCm39) missense probably benign 0.43
R7135:Rp1 UTSW 1 4,418,391 (GRCm39) missense possibly damaging 0.83
R7165:Rp1 UTSW 1 4,420,140 (GRCm39) missense probably damaging 0.99
R7199:Rp1 UTSW 1 4,417,513 (GRCm39) missense possibly damaging 0.73
R7232:Rp1 UTSW 1 4,298,824 (GRCm39) missense unknown
R7367:Rp1 UTSW 1 4,418,221 (GRCm39) missense probably benign 0.42
R7484:Rp1 UTSW 1 4,415,704 (GRCm39) missense probably benign 0.10
R7500:Rp1 UTSW 1 4,381,501 (GRCm39) missense unknown
R7569:Rp1 UTSW 1 4,355,063 (GRCm39) missense unknown
R7642:Rp1 UTSW 1 4,218,054 (GRCm39) missense unknown
R7693:Rp1 UTSW 1 4,417,626 (GRCm39) missense probably damaging 1.00
R7742:Rp1 UTSW 1 4,240,457 (GRCm39) missense unknown
R7759:Rp1 UTSW 1 4,415,107 (GRCm39) missense probably benign
R7784:Rp1 UTSW 1 4,212,881 (GRCm39) missense unknown
R7816:Rp1 UTSW 1 4,417,926 (GRCm39) missense probably damaging 0.98
R7866:Rp1 UTSW 1 4,417,924 (GRCm39) missense probably benign 0.02
R8215:Rp1 UTSW 1 4,315,318 (GRCm39) missense unknown
R8281:Rp1 UTSW 1 4,418,139 (GRCm39) missense probably damaging 1.00
R8294:Rp1 UTSW 1 4,416,220 (GRCm39) missense probably benign 0.09
R8309:Rp1 UTSW 1 4,417,312 (GRCm39) missense probably benign 0.00
R8311:Rp1 UTSW 1 4,418,572 (GRCm39) missense probably benign 0.11
R8500:Rp1 UTSW 1 4,416,813 (GRCm39) missense possibly damaging 0.91
R8559:Rp1 UTSW 1 4,419,784 (GRCm39) missense probably damaging 1.00
R8672:Rp1 UTSW 1 4,419,007 (GRCm39) missense possibly damaging 0.55
R8688:Rp1 UTSW 1 4,416,628 (GRCm39) missense probably benign 0.01
R8792:Rp1 UTSW 1 4,095,091 (GRCm39) missense unknown
R8859:Rp1 UTSW 1 4,420,183 (GRCm39) missense probably benign 0.07
R8945:Rp1 UTSW 1 4,419,817 (GRCm39) missense probably benign 0.42
R8959:Rp1 UTSW 1 4,419,650 (GRCm39) intron probably benign
R8979:Rp1 UTSW 1 4,218,937 (GRCm39) missense unknown
R9126:Rp1 UTSW 1 4,417,136 (GRCm39) missense probably damaging 0.99
R9156:Rp1 UTSW 1 4,234,161 (GRCm39) missense unknown
R9160:Rp1 UTSW 1 4,416,720 (GRCm39) missense probably benign 0.00
R9221:Rp1 UTSW 1 4,315,266 (GRCm39) missense unknown
R9263:Rp1 UTSW 1 4,419,160 (GRCm39) missense probably benign 0.02
R9263:Rp1 UTSW 1 4,418,675 (GRCm39) missense probably benign 0.25
R9302:Rp1 UTSW 1 4,416,789 (GRCm39) missense probably damaging 1.00
R9318:Rp1 UTSW 1 4,418,488 (GRCm39) missense probably benign 0.09
R9414:Rp1 UTSW 1 4,313,841 (GRCm39) missense unknown
R9474:Rp1 UTSW 1 4,162,838 (GRCm39) critical splice donor site probably null
R9478:Rp1 UTSW 1 4,417,545 (GRCm39) missense probably benign 0.06
R9529:Rp1 UTSW 1 4,416,447 (GRCm39) missense probably benign
R9572:Rp1 UTSW 1 4,418,662 (GRCm39) missense probably benign
R9673:Rp1 UTSW 1 4,337,792 (GRCm39) missense unknown
R9709:Rp1 UTSW 1 4,112,255 (GRCm39) missense unknown
R9716:Rp1 UTSW 1 4,212,833 (GRCm39) critical splice donor site probably null
RF003:Rp1 UTSW 1 4,414,917 (GRCm39) missense probably damaging 0.99
V1662:Rp1 UTSW 1 4,419,783 (GRCm39) missense probably damaging 1.00
X0012:Rp1 UTSW 1 4,417,918 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GATTCCAGATCATCAGTGCATTTG -3'
(R):5'- ATCCAGCCTTCATAGTGTGGAC -3'

Sequencing Primer
(F):5'- CAGATCATCAGTGCATTTGTTTTC -3'
(R):5'- AGCCTTCATAGTGTGGACGAGTG -3'
Posted On 2016-08-04