Incidental Mutation 'R5352:Corin'
ID423832
Institutional Source Beutler Lab
Gene Symbol Corin
Ensembl Gene ENSMUSG00000005220
Gene Namecorin
SynonymsLrp4
MMRRC Submission 042931-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R5352 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location72300025-72504473 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72305033 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 811 (S811N)
Ref Sequence ENSEMBL: ENSMUSP00000135889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005352] [ENSMUST00000167460] [ENSMUST00000175766] [ENSMUST00000176974] [ENSMUST00000177290]
Predicted Effect probably benign
Transcript: ENSMUST00000005352
AA Change: S952N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000005352
Gene: ENSMUSG00000005220
AA Change: S952N

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
FRI 205 318 6.15e-11 SMART
LDLa 336 372 1.31e-8 SMART
LDLa 373 408 1.5e-8 SMART
LDLa 409 447 5.47e-11 SMART
LDLa 448 484 1.22e-8 SMART
low complexity region 508 521 N/A INTRINSIC
FRI 522 643 2.75e-31 SMART
LDLa 647 684 2.19e-10 SMART
LDLa 685 722 1.76e-5 SMART
LDLa 723 759 4.18e-7 SMART
SR 758 853 3.99e-10 SMART
Tryp_SPc 868 1097 5.45e-76 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158570
Predicted Effect probably benign
Transcript: ENSMUST00000167460
AA Change: S886N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127389
Gene: ENSMUSG00000005220
AA Change: S886N

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 342 1.5e-8 SMART
LDLa 343 381 5.47e-11 SMART
LDLa 382 418 1.22e-8 SMART
low complexity region 442 455 N/A INTRINSIC
FRI 456 577 2.75e-31 SMART
LDLa 581 618 2.19e-10 SMART
LDLa 619 656 1.76e-5 SMART
LDLa 657 693 4.18e-7 SMART
SR 692 787 3.99e-10 SMART
Tryp_SPc 802 1031 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175766
AA Change: S811N

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000135889
Gene: ENSMUSG00000005220
AA Change: S811N

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
FRI 137 250 6.15e-11 SMART
LDLa 268 304 1.31e-8 SMART
LDLa 305 343 2.07e-11 SMART
low complexity region 367 380 N/A INTRINSIC
FRI 381 502 2.75e-31 SMART
LDLa 506 543 2.19e-10 SMART
LDLa 544 581 1.76e-5 SMART
LDLa 582 618 4.18e-7 SMART
SR 617 712 3.99e-10 SMART
Tryp_SPc 727 956 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176974
AA Change: S849N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000135722
Gene: ENSMUSG00000005220
AA Change: S849N

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 344 3.86e-11 SMART
LDLa 345 381 1.22e-8 SMART
low complexity region 405 418 N/A INTRINSIC
FRI 419 540 2.75e-31 SMART
LDLa 544 581 2.19e-10 SMART
LDLa 582 619 1.76e-5 SMART
LDLa 620 656 4.18e-7 SMART
SR 655 750 3.99e-10 SMART
Tryp_SPc 765 994 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177290
AA Change: S819N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135511
Gene: ENSMUSG00000005220
AA Change: S819N

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 72 185 6.15e-11 SMART
LDLa 203 239 1.31e-8 SMART
LDLa 240 275 1.5e-8 SMART
LDLa 276 314 5.47e-11 SMART
LDLa 315 351 1.22e-8 SMART
low complexity region 375 388 N/A INTRINSIC
FRI 389 510 2.75e-31 SMART
LDLa 514 551 2.19e-10 SMART
LDLa 552 589 1.76e-5 SMART
LDLa 590 626 4.18e-7 SMART
SR 625 720 3.99e-10 SMART
Tryp_SPc 735 964 5.45e-76 SMART
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates blood volume and pressure. This protein may also function as a pro-brain-type natriuretic peptide convertase. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display hypertension that is enhanced by high-salt diet and pregnancy, increased body weight, and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T G 16: 14,618,701 L206* probably null Het
Adgrv1 T C 13: 81,494,657 Y3218C probably damaging Het
Agtpbp1 G A 13: 59,473,746 T41M probably damaging Het
Akap6 A T 12: 52,796,097 E76V probably damaging Het
Ank2 C A 3: 127,498,991 probably benign Het
Atp6ap1l A C 13: 90,883,756 L269R probably damaging Het
Blk A G 14: 63,375,971 S363P probably damaging Het
Btnl9 T C 11: 49,178,840 N204S probably benign Het
Cc2d2a G T 5: 43,706,213 W672C probably damaging Het
Ccnf A G 17: 24,243,273 probably null Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Chst1 A G 2: 92,613,365 T61A possibly damaging Het
Col6a4 G A 9: 106,061,544 T1325I probably damaging Het
Col7a1 A C 9: 108,961,411 T976P unknown Het
Dnal1 T C 12: 84,136,548 V27A possibly damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
F830045P16Rik T A 2: 129,472,901 H152L probably damaging Het
Flnc A G 6: 29,449,318 S1405G possibly damaging Het
Foxj1 T C 11: 116,334,079 N154S possibly damaging Het
Gm12183 T C 11: 48,752,162 noncoding transcript Het
Gm27047 G A 6: 130,631,019 noncoding transcript Het
Grm5 A G 7: 88,074,850 I783V probably damaging Het
Hk1 A T 10: 62,304,770 S113T probably damaging Het
Iqca A T 1: 90,130,196 N260K probably benign Het
Iws1 A T 18: 32,083,404 K399M probably damaging Het
Kdm4d A G 9: 14,464,358 I68T probably damaging Het
Man2a1 T C 17: 64,731,246 I75T probably damaging Het
Med13 T A 11: 86,301,468 I824L possibly damaging Het
Meioc A T 11: 102,675,313 E585V probably benign Het
Mrgpre A C 7: 143,781,094 F224C probably damaging Het
Muc5b T A 7: 141,864,558 F3747Y possibly damaging Het
Nlrp4e T C 7: 23,353,173 V839A probably benign Het
Nup210 A T 6: 91,069,316 V545E probably damaging Het
Ola1 T C 2: 73,099,330 T310A probably damaging Het
Pdxdc1 T C 16: 13,840,311 N516S probably benign Het
Phlpp1 A G 1: 106,172,725 D241G probably benign Het
Ppp1r36 T C 12: 76,428,083 V85A probably damaging Het
Rasa3 A C 8: 13,631,778 L57R possibly damaging Het
Rp1 T C 1: 4,347,098 S1264G probably benign Het
Rprd1b A G 2: 158,058,736 E247G probably damaging Het
Sag G T 1: 87,812,993 V46L probably benign Het
Sat2 A T 11: 69,622,315 I17F probably damaging Het
Slc39a6 A T 18: 24,601,036 Y199N probably benign Het
Slc9a3r2 C T 17: 24,642,255 R66H probably damaging Het
Snx2 A G 18: 53,197,925 probably null Het
Thbs4 T C 13: 92,763,590 D466G probably damaging Het
Tmem208 A G 8: 105,328,431 D91G probably damaging Het
Tmf1 A G 6: 97,176,809 L101P probably damaging Het
Tnni1 A G 1: 135,805,592 T51A probably benign Het
Tor3a T G 1: 156,674,193 E38A probably damaging Het
Trim31 T A 17: 36,899,918 D147E possibly damaging Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Vmn1r48 G T 6: 90,036,147 A232E probably benign Het
Vmn1r89 T G 7: 13,219,357 F7V probably benign Het
Zfp160 A G 17: 21,026,852 T555A probably benign Het
Zfp981 C A 4: 146,537,005 T129K probably benign Het
Zfpm2 T A 15: 40,870,542 F106I probably benign Het
Other mutations in Corin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Corin APN 5 72304888 missense probably damaging 1.00
IGL01114:Corin APN 5 72305011 missense probably damaging 1.00
IGL01351:Corin APN 5 72338991 missense probably damaging 1.00
IGL01516:Corin APN 5 72454487 nonsense probably null
IGL01785:Corin APN 5 72339876 missense probably damaging 1.00
IGL01786:Corin APN 5 72339876 missense probably damaging 1.00
IGL01845:Corin APN 5 72353939 missense probably damaging 1.00
IGL02097:Corin APN 5 72372146 missense probably damaging 1.00
IGL02629:Corin APN 5 72332673 missense probably damaging 1.00
IGL03085:Corin APN 5 72353930 missense probably damaging 1.00
IGL03120:Corin APN 5 72360689 missense probably damaging 1.00
IGL03150:Corin APN 5 72302858 missense probably damaging 1.00
IGL03183:Corin APN 5 72301586 missense probably damaging 0.99
IGL03185:Corin APN 5 72332781 missense probably damaging 1.00
IGL03408:Corin APN 5 72342961 missense probably benign 0.40
alpaca UTSW 5 72503952 missense possibly damaging 0.85
R0078:Corin UTSW 5 72454473 missense possibly damaging 0.77
R0724:Corin UTSW 5 72332795 splice site probably benign
R1065:Corin UTSW 5 72301650 nonsense probably null
R1301:Corin UTSW 5 72304933 missense possibly damaging 0.81
R1466:Corin UTSW 5 72302790 critical splice donor site probably null
R1466:Corin UTSW 5 72302790 critical splice donor site probably null
R1520:Corin UTSW 5 72330895 missense probably damaging 1.00
R1584:Corin UTSW 5 72302790 critical splice donor site probably null
R1617:Corin UTSW 5 72503952 missense possibly damaging 0.85
R1912:Corin UTSW 5 72358403 missense probably damaging 1.00
R2059:Corin UTSW 5 72316051 missense possibly damaging 0.76
R2173:Corin UTSW 5 72504079 missense probably benign 0.01
R2242:Corin UTSW 5 72332711 missense probably damaging 1.00
R2373:Corin UTSW 5 72339038 missense probably damaging 1.00
R2850:Corin UTSW 5 72304955 missense probably damaging 1.00
R3683:Corin UTSW 5 72330855 missense probably damaging 1.00
R3684:Corin UTSW 5 72330855 missense probably damaging 1.00
R3790:Corin UTSW 5 72435298 missense probably benign 0.38
R3847:Corin UTSW 5 72422165 missense probably benign 0.13
R3926:Corin UTSW 5 72372130 missense probably damaging 1.00
R3939:Corin UTSW 5 72339879 missense possibly damaging 0.80
R3945:Corin UTSW 5 72358424 missense probably damaging 1.00
R4079:Corin UTSW 5 72503883 missense probably benign 0.03
R4224:Corin UTSW 5 72343108 missense probably damaging 1.00
R4473:Corin UTSW 5 72339057 missense probably damaging 1.00
R4585:Corin UTSW 5 72329699 missense probably damaging 1.00
R4586:Corin UTSW 5 72329699 missense probably damaging 1.00
R4849:Corin UTSW 5 72302835 missense probably damaging 1.00
R4926:Corin UTSW 5 72372182 missense probably damaging 1.00
R5080:Corin UTSW 5 72353851 intron probably benign
R5138:Corin UTSW 5 72339059 missense probably damaging 1.00
R5262:Corin UTSW 5 72304955 missense probably damaging 1.00
R5268:Corin UTSW 5 72343019 missense probably damaging 1.00
R5302:Corin UTSW 5 72316098 missense probably benign 0.07
R5307:Corin UTSW 5 72356978 missense probably damaging 1.00
R5324:Corin UTSW 5 72435257 missense probably damaging 1.00
R5373:Corin UTSW 5 72304953 missense probably damaging 1.00
R5374:Corin UTSW 5 72304953 missense probably damaging 1.00
R5484:Corin UTSW 5 72358484 missense probably benign 0.15
R5502:Corin UTSW 5 72316106 nonsense probably null
R5544:Corin UTSW 5 72305014 nonsense probably null
R5682:Corin UTSW 5 72422154 missense possibly damaging 0.85
R5818:Corin UTSW 5 72435395 missense probably benign 0.00
R5992:Corin UTSW 5 72316389 missense probably benign 0.01
R6115:Corin UTSW 5 72360729 missense probably damaging 1.00
R6181:Corin UTSW 5 72372096 critical splice donor site probably null
R6317:Corin UTSW 5 72339045 missense probably damaging 1.00
R7053:Corin UTSW 5 72301527 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TGGCTGATGACGCTCACTTAC -3'
(R):5'- CGGAAGAAGTCTGAGCTTTGC -3'

Sequencing Primer
(F):5'- GATGACGCTCACTTACTTTTATTGC -3'
(R):5'- GAAGAAGTCTGAGCTTTGCTTCCTC -3'
Posted On2016-08-04