Incidental Mutation 'R5353:Aprt'
List |< first << previous [record 84 of 1308] next >> last >|
ID423909
Institutional Source Beutler Lab
Gene Symbol Aprt
Ensembl Gene ENSMUSG00000006589
Gene Nameadenine phosphoribosyl transferase
Synonyms
MMRRC Submission 042932-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.649) question?
Stock #R5353 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location122574635-122576909 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 122575408 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000148607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006760] [ENSMUST00000006764] [ENSMUST00000015171] [ENSMUST00000127664] [ENSMUST00000211823] [ENSMUST00000212093] [ENSMUST00000212319] [ENSMUST00000213029] [ENSMUST00000213062]
Predicted Effect probably benign
Transcript: ENSMUST00000006760
SMART Domains Protein: ENSMUSP00000006760
Gene: ENSMUSG00000006585

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
low complexity region 59 70 N/A INTRINSIC
low complexity region 72 108 N/A INTRINSIC
CDT1 199 362 3.68e-91 SMART
low complexity region 401 427 N/A INTRINSIC
Pfam:CDT1_C 431 525 1.4e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000006764
AA Change: Y105*
SMART Domains Protein: ENSMUSP00000006764
Gene: ENSMUSG00000006589
AA Change: Y105*

DomainStartEndE-ValueType
Pfam:Pribosyltran 28 178 2.3e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000015171
SMART Domains Protein: ENSMUSP00000015171
Gene: ENSMUSG00000015027

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 28 353 2.3e-91 PFAM
Pfam:Phosphodiest 30 315 2.1e-11 PFAM
Pfam:Sulfatase_C 376 507 2.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211810
Predicted Effect probably null
Transcript: ENSMUST00000211823
AA Change: M1K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212053
Predicted Effect probably null
Transcript: ENSMUST00000212093
AA Change: M1K
Predicted Effect probably null
Transcript: ENSMUST00000212319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213017
Predicted Effect probably benign
Transcript: ENSMUST00000213029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213030
Predicted Effect probably null
Transcript: ENSMUST00000213062
AA Change: M1K
Meta Mutation Damage Score 0.6184 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenine phosphoribosyltransferase belongs to the purine/pyrimidine phosphoribosyltransferase family. A conserved feature of this gene is the distribution of CpG dinucleotides. This enzyme catalyzes the formation of AMP and inorganic pyrophosphate from adenine and 5-phosphoribosyl-1-pyrophosphate (PRPP). It also produces adenine as a by-product of the polyamine biosynthesis pathway. A homozygous deficiency in this enzyme causes 2,8-dihydroxyadenine urolithiasis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygous null mutants may die by 6 months of age with highly abnormal kidney morphology and kidney tubule obstructions depending on the genetic background. Mice have elevated urinary 2,8-hydroxyadenine and crystalline deposits in kidney. Severity varies by genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A G 18: 61,801,399 S649P probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Adamts1 T A 16: 85,802,608 M35L probably benign Het
Adgrg3 A T 8: 95,035,928 H202L probably damaging Het
Anln G T 9: 22,360,517 R681S probably damaging Het
Arid3b G T 9: 57,795,037 probably null Het
BC080695 A G 4: 143,571,237 T76A probably benign Het
Cbl A G 9: 44,173,323 F172L probably damaging Het
Cd109 G T 9: 78,710,239 V1340L probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Chrm3 A G 13: 9,878,557 Y148H probably damaging Het
Cog7 A C 7: 121,941,247 probably null Het
Cpsf1 A T 15: 76,602,571 I255N probably damaging Het
Crebzf G A 7: 90,443,414 G134R probably damaging Het
Crybg1 T C 10: 43,973,665 S1705G probably damaging Het
Dock6 A T 9: 21,814,786 H1409Q probably benign Het
Fank1 A G 7: 133,876,903 D232G probably damaging Het
Fat1 G T 8: 45,036,131 V3480L probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fmn2 G T 1: 174,503,006 G321W unknown Het
Greb1 A T 12: 16,688,566 Y1465* probably null Het
Hdac9 G A 12: 34,393,393 Q330* probably null Het
Kcnt2 C T 1: 140,426,901 T298I probably damaging Het
Knl1 A G 2: 119,070,983 D1055G probably benign Het
Mroh2b T C 15: 4,917,178 S487P probably damaging Het
Naa38 G A 11: 69,396,582 V110I probably benign Het
Nkd2 T C 13: 73,821,438 H303R probably damaging Het
Nr1d2 A G 14: 18,222,125 C49R probably benign Het
Olfr1216 A G 2: 89,013,755 V103A probably benign Het
Olfr691 A G 7: 105,337,117 Y200H probably damaging Het
Ovch2 T A 7: 107,794,424 E165V probably damaging Het
Phyh A T 2: 4,942,201 probably benign Het
Pik3r4 G A 9: 105,667,938 probably null Het
Ppip5k1 A C 2: 121,311,720 V1416G probably benign Het
Ppm1b T C 17: 84,994,109 V139A probably benign Het
Ppp1r12a T G 10: 108,261,216 probably null Het
Psmc5 G T 11: 106,261,501 A115S probably damaging Het
Ptpn5 T A 7: 47,081,894 E409V probably benign Het
Ptprg T A 14: 11,554,235 probably benign Het
Qrich1 G T 9: 108,544,965 V593F probably damaging Het
Rbbp9 T C 2: 144,543,821 I175V probably benign Het
Selenot T C 3: 58,585,966 F88S possibly damaging Het
Sp110 C T 1: 85,589,120 E219K possibly damaging Het
Spred2 A G 11: 20,018,155 D208G possibly damaging Het
Surf1 T C 2: 26,914,192 T197A probably benign Het
Taco1 G A 11: 106,072,713 probably null Het
Tas2r109 A G 6: 132,980,631 V112A possibly damaging Het
Tpr C T 1: 150,445,924 R3C probably damaging Het
Uggt2 A G 14: 119,081,770 I280T probably benign Het
Yipf2 A G 9: 21,591,932 Y80H possibly damaging Het
Zscan12 T C 13: 21,364,008 V120A possibly damaging Het
Other mutations in Aprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Aprt APN 8 122575493 missense probably benign 0.12
R0749:Aprt UTSW 8 122575410 missense probably damaging 1.00
R3787:Aprt UTSW 8 122575529 missense probably benign 0.02
R4610:Aprt UTSW 8 122575415 utr 5 prime probably null
R6526:Aprt UTSW 8 122576816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTCCAGCTCAGCCTGCAG -3'
(R):5'- ATACTTGGCCTCTAGATTCCCATG -3'

Sequencing Primer
(F):5'- AAGTAGTGTAAGACAGAGTCTAGGC -3'
(R):5'- AGATTCCCATGCCCCTCAG -3'
Posted On2016-08-04