Incidental Mutation 'R5354:Anxa7'
ID423995
Institutional Source Beutler Lab
Gene Symbol Anxa7
Ensembl Gene ENSMUSG00000021814
Gene Nameannexin A7
Synonymssynexin, Anx7
MMRRC Submission 042933-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R5354 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location20455260-20480133 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20464909 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 177 (L177P)
Ref Sequence ENSEMBL: ENSMUSP00000098405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065504] [ENSMUST00000100844] [ENSMUST00000224975] [ENSMUST00000225941]
Predicted Effect probably benign
Transcript: ENSMUST00000065504
AA Change: L155P

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000066035
Gene: ENSMUSG00000021814
AA Change: L155P

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 37 103 N/A INTRINSIC
low complexity region 111 129 N/A INTRINSIC
ANX 177 229 5.92e-26 SMART
ANX 249 301 3.12e-25 SMART
ANX 333 385 1.03e-11 SMART
ANX 408 460 2e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100844
AA Change: L177P

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000098405
Gene: ENSMUSG00000021814
AA Change: L177P

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 37 103 N/A INTRINSIC
low complexity region 111 129 N/A INTRINSIC
ANX 177 229 5.92e-26 SMART
ANX 249 301 3.12e-25 SMART
ANX 333 385 1.03e-11 SMART
ANX 408 460 2e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224410
Predicted Effect probably benign
Transcript: ENSMUST00000224975
AA Change: L155P

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225118
Predicted Effect probably benign
Transcript: ENSMUST00000225941
AA Change: L13P

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Annexin VII is a member of the annexin family of calcium-dependent phospholipid binding proteins.The Annexin VII gene contains 14 exons and spans approximately 34 kb of DNA. An alternatively spliced cassette exon results in two mRNA transcripts of 2.0 and 2.4 kb which are predicted to generate two protein isoforms differing in their N-terminal domain. The alternative splicing event is tissue specific and the mRNA containing the cassette exon is prevalent in brain, heart and skeletal muscle. The transcripts also differ in their 3'-non coding regions by the use of two alternative poly(A) signals. Annexin VII encodes a protein with a molecular weight of approximately 51 kDa with a unique, highly hydrophobic N-terminal domain of 167 amino acids and a conserved C-terminal region of 299 amino acids. The latter domain is composed of alternating hydrophobic and hydrophilic segments. Structural analysis of the protein suggests that Annexin VII is a membrane binding protein with diverse properties, including voltage-sensitive calcium channel activity, ion selectivity and membrane fusion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele are viable but exhibit altered Ca2+ signaling and/or homeostasis in cardiomyocytes and glia cells, and changes in erythrocyte shape, osmotic resistance, platelet number and aggregation velocity. Homozygotes for another null allele die at ~E10 with cerebral hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A G 16: 14,618,671 K196R probably benign Het
Ablim1 T C 19: 57,130,923 E243G probably benign Het
Acat1 T A 9: 53,589,183 E271V possibly damaging Het
Aco1 T C 4: 40,180,290 probably null Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Agbl3 T A 6: 34,814,752 H596Q probably benign Het
Atp11a A T 8: 12,806,753 N48I probably damaging Het
Bcas1 T A 2: 170,349,396 N492I possibly damaging Het
Bclaf1 A G 10: 20,333,532 Y498C probably damaging Het
Bod1l A C 5: 41,831,537 V409G probably damaging Het
Ccdc170 G A 10: 4,534,188 C338Y probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Ckap2 A C 8: 22,177,565 N93K probably damaging Het
Clca3a1 A T 3: 144,737,005 S759R possibly damaging Het
Coro1c A T 5: 113,846,165 I347N possibly damaging Het
Cpox A G 16: 58,670,842 T139A probably damaging Het
Cyp4a12b C A 4: 115,433,464 probably null Het
Dctn1 T G 6: 83,183,126 V116G possibly damaging Het
Dhx38 A G 8: 109,555,746 V683A probably damaging Het
Dnah12 G A 14: 26,774,342 probably null Het
Dnajb7 T C 15: 81,408,007 E43G probably damaging Het
Dsc1 A T 18: 20,087,575 V714E probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Egfem1 T C 3: 29,082,212 probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fmo1 T C 1: 162,830,145 T476A probably benign Het
Gm10237 T C 16: 35,920,729 noncoding transcript Het
Gm14496 A G 2: 182,000,809 S758G probably damaging Het
Gpat2 T A 2: 127,428,723 L97Q probably damaging Het
Gpr162 T C 6: 124,859,637 D357G probably benign Het
Hax1 A T 3: 89,997,955 D34E probably damaging Het
Hmgcr C T 13: 96,654,896 V97M probably benign Het
Hsd3b2 T C 3: 98,712,315 T105A probably benign Het
Ints1 A G 5: 139,766,428 probably null Het
Islr T C 9: 58,157,612 E204G probably damaging Het
Lrrc36 A G 8: 105,425,364 N60D probably damaging Het
Maf1 T C 15: 76,353,130 probably benign Het
Mrgprb4 T A 7: 48,198,329 R284W probably benign Het
Myh4 A T 11: 67,255,725 N1508I possibly damaging Het
Nufip2 A G 11: 77,686,277 H17R unknown Het
Oasl1 A T 5: 114,936,996 I372L probably damaging Het
Olfr290 T A 7: 84,916,149 Y123* probably null Het
Olfr414 T C 1: 174,430,686 L86P probably damaging Het
Pald1 A T 10: 61,348,661 Y226N probably damaging Het
Pcdhb13 G T 18: 37,444,791 G741C probably damaging Het
Pcdhga10 A G 18: 37,748,206 D340G probably damaging Het
Pclo C A 5: 14,678,808 probably benign Het
Pcsk4 G T 10: 80,323,689 N416K probably damaging Het
Pde10a C A 17: 8,961,980 R398S probably damaging Het
Plin1 T A 7: 79,725,721 T227S possibly damaging Het
Pnpt1 A G 11: 29,154,166 D542G probably damaging Het
Ppp4r3b T A 11: 29,211,646 D673E probably benign Het
Prr18 C A 17: 8,341,060 P16Q probably damaging Het
Psmc3 T A 2: 91,059,353 Y440N probably damaging Het
Rassf5 T C 1: 131,180,648 I232V probably benign Het
Rims1 T A 1: 22,538,511 D218V probably damaging Het
Skint10 T C 4: 112,711,593 N309S possibly damaging Het
Slc6a1 T C 6: 114,302,623 M121T possibly damaging Het
Slit3 A G 11: 35,675,913 D1004G probably damaging Het
Snap91 C T 9: 86,835,124 V215I possibly damaging Het
Son T C 16: 91,655,739 L458S probably damaging Het
St18 C T 1: 6,844,171 A782V probably damaging Het
Synpo A G 18: 60,602,231 probably null Het
Thbs3 A G 3: 89,221,377 D458G probably damaging Het
Tpr C T 1: 150,445,924 R3C probably damaging Het
Trp63 A G 16: 25,684,355 probably null Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Vmn1r27 C A 6: 58,215,596 R141L probably benign Het
Wnk1 T C 6: 119,968,523 I699V probably benign Het
Xkr6 A G 14: 63,818,904 D88G possibly damaging Het
Zan A G 5: 137,380,788 probably benign Het
Zbtb7b T C 3: 89,379,606 probably benign Het
Zfp618 A T 4: 63,080,028 D33V probably damaging Het
Other mutations in Anxa7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Anxa7 APN 14 20458681 missense possibly damaging 0.87
IGL01137:Anxa7 APN 14 20456580 nonsense probably null
IGL01376:Anxa7 APN 14 20460456 missense probably benign 0.00
IGL01651:Anxa7 APN 14 20456501 missense probably damaging 1.00
IGL02830:Anxa7 APN 14 20456540 missense possibly damaging 0.67
IGL03078:Anxa7 APN 14 20456556 missense probably damaging 0.97
IGL03177:Anxa7 APN 14 20456586 missense probably benign 0.41
FR4449:Anxa7 UTSW 14 20469411 missense probably damaging 0.97
FR4548:Anxa7 UTSW 14 20469411 missense probably damaging 0.97
FR4737:Anxa7 UTSW 14 20469411 missense probably damaging 0.97
FR4976:Anxa7 UTSW 14 20469411 missense probably damaging 0.97
LCD18:Anxa7 UTSW 14 20469411 missense probably damaging 0.97
R0049:Anxa7 UTSW 14 20462610 missense probably damaging 1.00
R0049:Anxa7 UTSW 14 20462610 missense probably damaging 1.00
R0121:Anxa7 UTSW 14 20460159 missense probably damaging 0.97
R0329:Anxa7 UTSW 14 20469498 splice site probably null
R0330:Anxa7 UTSW 14 20469498 splice site probably null
R1416:Anxa7 UTSW 14 20462707 missense probably damaging 1.00
R1601:Anxa7 UTSW 14 20464615 nonsense probably null
R1701:Anxa7 UTSW 14 20460161 missense probably damaging 1.00
R1794:Anxa7 UTSW 14 20471467 missense unknown
R1828:Anxa7 UTSW 14 20462664 missense probably damaging 1.00
R4676:Anxa7 UTSW 14 20467915 missense probably benign 0.00
R6547:Anxa7 UTSW 14 20469393 missense probably benign 0.13
R6985:Anxa7 UTSW 14 20471568 missense unknown
R7226:Anxa7 UTSW 14 20460195 missense probably damaging 0.97
R7267:Anxa7 UTSW 14 20469406 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACATCCACAATTGCTTGCTCG -3'
(R):5'- CTGTTCATGAGGCCTGGTAATAC -3'

Sequencing Primer
(F):5'- CGTCTGTCCCTGGAAGAGTCATAG -3'
(R):5'- CATGAGGCCTGGTAATACATCTC -3'
Posted On2016-08-04