Mutagenetix > Incidental Mutation

Incidental Mutation 'R5355:Cryab'

424046

Institutional Source

Beutler Lab

Gene Symbol

Cryab

Ensembl Gene

ENSMUSG00000032060

Gene Name

crystallin, alpha B

Synonyms

Crya2, HspB5, Crya-2, alpha B-crystallin

MMRRC Submission

042934-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.389) question?

Stock #

R5355 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

50662625-50667936 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 50664751 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 59 (S59C)

Ref Sequence

ENSEMBL: ENSMUSP00000149454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034562] [ENSMUST00000042790] [ENSMUST00000214609] [ENSMUST00000214962] [ENSMUST00000216755] [ENSMUST00000217159] [ENSMUST00000217475]

AlphaFold

P23927

Predicted Effect

probably benign
Transcript: ENSMUST00000034562
AA Change: S59C

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000034562
Gene: ENSMUSG00000032060
AA Change: S59C

Domain	Start	End	E-Value	Type
Pfam:Crystallin	1	56	7.3e-32	PFAM
Pfam:HSP20	67	162	2.1e-27	PFAM
low complexity region	166	175	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000042790

SMART Domains

Protein: ENSMUSP00000042374
Gene: ENSMUSG00000038086

Domain	Start	End	E-Value	Type
Pfam:Crystallin	14	55	1.6e-8	PFAM
Pfam:HSP20	66	163	5.7e-19	PFAM
low complexity region	166	182	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000214609
AA Change: S59C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000214962
AA Change: S59C

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216393

Predicted Effect

probably benign
Transcript: ENSMUST00000216755
AA Change: S59C

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)

Predicted Effect

probably benign
Transcript: ENSMUST00000217159

Predicted Effect

probably benign
Transcript: ENSMUST00000217475
AA Change: S59C

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)

Meta Mutation Damage Score

0.3401

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.2%

Validation Efficiency

94% (50/53)

MGI Phenotype

FUNCTION: This gene encodes a member of the small heat-shock protein (HSP20) family. The encoded protein is a molecular chaperone that protects proteins against thermal denaturation and other stresses. This protein is a component of the eye lens, regulates lens differentiation and functions as a refractive element in the lens. This protein is a negative regulator of inflammation, has anti-apoptotic properties and also plays a role in the formation of muscular tissue. Mice lacking this gene exhibit worse experimental autoimmune encephalomyelitis and inflammation of the central nervous system compared to the wild type. In mouse models, this gene has a critical role in alleviating the pathology of the neurodegenerative Alexander disease. Mutations in the human gene are associated with myofibrillar myopathy 2, fatal infantile hypertonic myofibrillar myopathy, multiple types of cataract and dilated cardiomyopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous or heterozygous for a knock-in allele exhibit decreased grip strength and develop cataracts and myopathy; some mice display unilateral corneal abnormalities and small eyes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	T	C	5: 8,776,873 (GRCm39)	L857P	probably damaging	Het
Adam12	T	C	7: 133,489,671 (GRCm39)	*582W	probably null	Het
Adra1d	A	G	2: 131,403,007 (GRCm39)	V361A	probably damaging	Het
Ank2	A	G	3: 126,737,698 (GRCm39)		probably benign	Het
Atxn10	T	A	15: 85,346,515 (GRCm39)	N424K	probably damaging	Het
C8b	A	G	4: 104,637,860 (GRCm39)	T111A	probably benign	Het
Ccdc168	A	C	1: 44,097,139 (GRCm39)	C1320G	possibly damaging	Het
Cdc45	C	T	16: 18,614,647 (GRCm39)	R205H	probably damaging	Het
Cdr2l	T	C	11: 115,284,396 (GRCm39)	V244A	possibly damaging	Het
Col11a2	A	G	17: 34,270,775 (GRCm39)	M468V	probably benign	Het
Col4a2	G	A	8: 11,495,984 (GRCm39)	R1535H	probably damaging	Het
Cuzd1	G	A	7: 130,917,853 (GRCm39)	T249I	probably damaging	Het
Disp2	G	A	2: 118,617,392 (GRCm39)	V129M	probably benign	Het
Dlg2	G	T	7: 91,099,011 (GRCm39)	R31L	probably benign	Het
Dthd1	A	C	5: 62,996,730 (GRCm39)	L488F	probably damaging	Het
Dusp29	G	A	14: 21,727,091 (GRCm39)	R186W	probably benign	Het
Fat2	T	G	11: 55,172,992 (GRCm39)	I2574L	probably damaging	Het
Fchsd1	C	T	18: 38,092,926 (GRCm39)		probably benign	Het
Fryl	T	C	5: 73,231,247 (GRCm39)	D1610G	probably damaging	Het
Gm10330	T	A	12: 23,830,131 (GRCm39)	N17Y	probably damaging	Het
Gm4787	T	A	12: 81,424,239 (GRCm39)	R640*	probably null	Het
H2bc13	A	T	13: 21,900,030 (GRCm39)	I95N	probably damaging	Het
Ift88	T	A	14: 57,675,699 (GRCm39)	S71T	probably benign	Het
Isoc2b	A	G	7: 4,852,357 (GRCm39)		probably benign	Het
Itgb2	G	T	10: 77,393,886 (GRCm39)	R442L	probably benign	Het
Lama5	A	T	2: 179,823,444 (GRCm39)	N2658K	possibly damaging	Het
Lemd3	A	T	10: 120,769,538 (GRCm39)	I598K	probably damaging	Het
Lrp2	A	T	2: 69,285,182 (GRCm39)	C3825*	probably null	Het
Mep1a	T	C	17: 43,788,037 (GRCm39)	D673G	probably damaging	Het
Met	A	G	6: 17,491,361 (GRCm39)	Y41C	probably damaging	Het
Mfn2	A	G	4: 147,979,035 (GRCm39)	V99A	probably damaging	Het
Mmadhc	A	G	2: 50,181,436 (GRCm39)	I78T	probably benign	Het
Mmp9	C	A	2: 164,792,912 (GRCm39)	P389T	possibly damaging	Het
Mvk	T	G	5: 114,590,499 (GRCm39)	S7A	probably damaging	Het
Nlrp1a	T	A	11: 71,015,077 (GRCm39)	T58S	probably benign	Het
Nlrp1c-ps	C	A	11: 71,148,839 (GRCm39)		noncoding transcript	Het
Nr1h3	A	G	2: 91,022,253 (GRCm39)	I125T	possibly damaging	Het
Or2a55-ps1	C	T	6: 43,071,598 (GRCm39)		noncoding transcript	Het
Or8k39	A	T	2: 86,563,680 (GRCm39)	I92K	probably damaging	Het
Parn	A	G	16: 13,485,886 (GRCm39)	I3T	possibly damaging	Het
Parp8	A	G	13: 116,998,740 (GRCm39)		probably null	Het
Parva	T	C	7: 112,143,475 (GRCm39)		probably null	Het
Pwp2	A	C	10: 78,011,378 (GRCm39)	I672M	possibly damaging	Het
Sfswap	C	T	5: 129,616,810 (GRCm39)	T418I	probably benign	Het
Slc6a3	A	G	13: 73,709,078 (GRCm39)	Y334C	probably damaging	Het
Slc7a13	C	A	4: 19,839,267 (GRCm39)	T290K	probably benign	Het
Spry2	A	G	14: 106,130,712 (GRCm39)	L158P	probably damaging	Het
Usp25	A	G	16: 76,847,342 (GRCm39)	E150G	probably damaging	Het
Zfp747	A	G	7: 126,973,769 (GRCm39)	F134L	possibly damaging	Het
Zp3r	A	G	1: 130,524,518 (GRCm39)	F175S	probably benign	Het
Zscan22	C	A	7: 12,640,435 (GRCm39)	N67K	probably benign	Het

Other mutations in Cryab

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01073:Cryab	APN	9	50,665,855 (GRCm39)	missense	probably damaging	1.00
R3029:Cryab	UTSW	9	50,667,638 (GRCm39)	missense	probably damaging	0.98
R4999:Cryab	UTSW	9	50,665,909 (GRCm39)	missense	possibly damaging	0.92
R5427:Cryab	UTSW	9	50,667,593 (GRCm39)	missense	probably damaging	1.00
R6192:Cryab	UTSW	9	50,665,813 (GRCm39)	missense	probably damaging	0.97
R6272:Cryab	UTSW	9	50,665,825 (GRCm39)	missense	possibly damaging	0.80
R6993:Cryab	UTSW	9	50,664,748 (GRCm39)	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TAGCCACAATGGACATCGCC -3'
(R):5'- GACTATGACCCTCACCATGC -3'

Sequencing Primer
(F):5'- TGGACATCGCCATCCACC -3'
(R):5'- TGGACCAGGAAACCGAGCATC -3'

Posted On

2016-08-04