Incidental Mutation 'R5356:Gstm1'
ID424087
Institutional Source Beutler Lab
Gene Symbol Gstm1
Ensembl Gene ENSMUSG00000058135
Gene Nameglutathione S-transferase, mu 1
SynonymsGstb-1, Gstb1
MMRRC Submission 042935-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R5356 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location108012255-108017973 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108012736 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 180 (I180F)
Ref Sequence ENSEMBL: ENSMUSP00000123481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004140] [ENSMUST00000126593] [ENSMUST00000153314]
Predicted Effect probably benign
Transcript: ENSMUST00000004140
AA Change: I204F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000004140
Gene: ENSMUSG00000058135
AA Change: I204F

DomainStartEndE-ValueType
Pfam:GST_N 3 82 1.3e-20 PFAM
Pfam:GST_C_3 40 190 5.2e-11 PFAM
Pfam:GST_C 104 192 3.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126593
AA Change: I230F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000118874
Gene: ENSMUSG00000058135
AA Change: I230F

DomainStartEndE-ValueType
Pfam:GST_N 3 82 8.3e-24 PFAM
Pfam:GST_C 104 201 6.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153314
AA Change: I180F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000123481
Gene: ENSMUSG00000058135
AA Change: I180F

DomainStartEndE-ValueType
Pfam:GST_N 1 23 1.7e-7 PFAM
Pfam:GST_C 45 168 1.2e-18 PFAM
Pfam:GST_C_3 92 166 8.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198532
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Diversification of these genes has occurred in regions encoding substrate-binding domains, as well as in tissue expression patterns, to accommodate an increasing number of foreign compounds. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for the deletion of this gene display a reduced ability to metabolize 1,2-dichloro-4-nitrobenzene. Mice homozygous for a different knock-out allele exhibit abnormal behavior, altered response to valproic acid, and increased serotonin and dopamine levels in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 C T 3: 37,065,256 T162I probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Amn1 T C 6: 149,166,894 I205M possibly damaging Het
Ankrd50 A C 3: 38,456,185 S678A probably damaging Het
Atg13 G A 2: 91,692,466 R78* probably null Het
Bmper T G 9: 23,373,861 F235L probably benign Het
Btn2a2 C T 13: 23,482,875 V187I probably benign Het
Cabs1 G A 5: 87,979,633 V48I probably benign Het
Cacnb3 A G 15: 98,641,617 I212V probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cep162 T C 9: 87,206,895 E978G probably damaging Het
Cmya5 A T 13: 93,063,485 L3445Q probably damaging Het
Cntrl T A 2: 35,148,899 L1067* probably null Het
Cyp20a1 G A 1: 60,379,387 V329I probably benign Het
Cyp2d11 A T 15: 82,390,511 N288K probably benign Het
D430041D05Rik T G 2: 104,255,409 T932P probably damaging Het
Dlk1 T A 12: 109,455,521 C54S probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Entpd6 T A 2: 150,770,383 F416L probably damaging Het
Evx1 A G 6: 52,316,617 T257A probably benign Het
Fpr-rs3 A T 17: 20,624,334 S182T probably damaging Het
Glra3 A T 8: 55,940,901 I16F probably benign Het
Gm11437 C A 11: 84,152,687 L259F possibly damaging Het
Gorasp1 A T 9: 119,927,958 L386Q probably damaging Het
Gpsm1 T C 2: 26,340,562 V508A possibly damaging Het
Hc T C 2: 34,994,995 D1400G probably benign Het
Lrp2 A G 2: 69,464,708 V3422A possibly damaging Het
Map3k4 A G 17: 12,247,308 V1128A possibly damaging Het
Mboat2 G C 12: 24,957,573 V363L probably benign Het
Mgat3 A G 15: 80,211,610 I213V possibly damaging Het
Mgat3 A G 15: 80,212,454 N494S probably damaging Het
Mtf2 A T 5: 108,106,610 T426S possibly damaging Het
Muc3a T C 5: 137,210,564 I151V probably benign Het
Myh6 T C 14: 54,953,762 E874G probably damaging Het
Myo15 G A 11: 60,498,366 G2030R probably damaging Het
Ncdn T C 4: 126,747,228 Y493C probably damaging Het
Ncoa6 A G 2: 155,421,192 F441L probably damaging Het
Ndc80 A T 17: 71,521,108 S75T possibly damaging Het
Nf1 T C 11: 79,473,456 F1571L possibly damaging Het
Nme8 A G 13: 19,652,299 F236L probably damaging Het
Nsmce4a C A 7: 130,537,048 V289L probably damaging Het
Ntrk2 A T 13: 59,060,242 D634V probably damaging Het
Pcsk6 G C 7: 65,970,592 E479Q probably damaging Het
Pkd1 A G 17: 24,593,577 Q3828R probably damaging Het
Ptov1 T A 7: 44,864,665 T295S probably damaging Het
Ptprf A G 4: 118,226,338 M824T probably benign Het
Rbm6 T A 9: 107,852,666 H129L probably damaging Het
Rbm8a2 A G 1: 175,978,689 I74T possibly damaging Het
Ret A G 6: 118,197,118 S6P possibly damaging Het
Rspo3 A T 10: 29,500,068 C70* probably null Het
Sike1 C A 3: 103,001,790 A202D possibly damaging Het
Slc9a3r2 A G 17: 24,641,971 V88A probably damaging Het
Slco4c1 G T 1: 96,832,110 P499H probably damaging Het
Smg1 A G 7: 118,195,133 probably benign Het
Tmem135 A G 7: 89,305,515 V98A probably benign Het
Tor4a T A 2: 25,195,906 probably null Het
Txlna A G 4: 129,630,373 F397S probably damaging Het
Tyk2 A G 9: 21,115,744 I581T probably benign Het
Unc13a C T 8: 71,662,514 D164N probably benign Het
Vwa3b T C 1: 37,114,583 I502T probably damaging Het
Xrcc6 A G 15: 82,029,218 T6A probably benign Het
Zfp524 T C 7: 5,018,433 V320A probably benign Het
Other mutations in Gstm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0335:Gstm1 UTSW 3 108012696 missense possibly damaging 0.87
R0458:Gstm1 UTSW 3 108017363 missense probably benign 0.01
R0907:Gstm1 UTSW 3 108017380 missense probably damaging 1.00
R1069:Gstm1 UTSW 3 108012748 missense probably damaging 1.00
R1180:Gstm1 UTSW 3 108014811 missense probably damaging 1.00
R1181:Gstm1 UTSW 3 108014811 missense probably damaging 1.00
R1998:Gstm1 UTSW 3 108014811 missense probably damaging 1.00
R2000:Gstm1 UTSW 3 108014811 missense probably damaging 1.00
R4483:Gstm1 UTSW 3 108016518 critical splice donor site probably null
R4857:Gstm1 UTSW 3 108016408 missense possibly damaging 0.67
R5192:Gstm1 UTSW 3 108014943 critical splice donor site probably null
R5262:Gstm1 UTSW 3 108016363 missense probably benign 0.01
R5485:Gstm1 UTSW 3 108017404 missense probably damaging 1.00
R6323:Gstm1 UTSW 3 108017747 missense probably benign 0.44
R7165:Gstm1 UTSW 3 108016377 missense probably benign
R7250:Gstm1 UTSW 3 108016393 missense probably damaging 0.98
X0023:Gstm1 UTSW 3 108012727 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGGCTGTGTGGACTTGAC -3'
(R):5'- CCCTTGAATATGGGGAATGGG -3'

Sequencing Primer
(F):5'- CTGACCAAGCTGCAGAAGG -3'
(R):5'- CTGGGCTGGAGCTAAGCAG -3'
Posted On2016-08-04