Incidental Mutation 'R5356:Ptprf'
ID424089
Institutional Source Beutler Lab
Gene Symbol Ptprf
Ensembl Gene ENSMUSG00000033295
Gene Nameprotein tyrosine phosphatase, receptor type, F
SynonymsRPTP-LAR, LAR
MMRRC Submission 042935-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.742) question?
Stock #R5356 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location118208213-118291405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118226338 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 824 (M824T)
Ref Sequence ENSEMBL: ENSMUSP00000039368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049074]
PDB Structure
Tandem Ig domains of tyrosine phosphatase LAR [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000049074
AA Change: M824T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000039368
Gene: ENSMUSG00000033295
AA Change: M824T

DomainStartEndE-ValueType
IGc2 45 114 2.64e-12 SMART
IGc2 147 214 1.48e-15 SMART
IG 238 316 1.06e-11 SMART
FN3 319 398 6.9e-14 SMART
FN3 414 497 5.73e-11 SMART
FN3 512 591 4.06e-11 SMART
FN3 606 693 8.69e-11 SMART
FN3 709 797 8.83e-12 SMART
FN3 812 892 3.2e-9 SMART
FN3 907 988 2.53e-12 SMART
FN3 1003 1079 3.48e-1 SMART
coiled coil region 1146 1175 N/A INTRINSIC
transmembrane domain 1253 1275 N/A INTRINSIC
PTPc 1342 1600 1.12e-138 SMART
PTPc 1629 1891 3.4e-129 SMART
Predicted Effect unknown
Transcript: ENSMUST00000124758
AA Change: M246T
SMART Domains Protein: ENSMUSP00000119954
Gene: ENSMUSG00000033295
AA Change: M246T

DomainStartEndE-ValueType
FN3 37 116 4.06e-11 SMART
FN3 132 220 8.83e-12 SMART
FN3 235 315 3.2e-9 SMART
FN3 330 411 2.53e-12 SMART
FN3 426 502 3.48e-1 SMART
coiled coil region 568 597 N/A INTRINSIC
transmembrane domain 676 698 N/A INTRINSIC
PTPc 776 1034 1.12e-138 SMART
PTPc 1063 1325 3.4e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143348
Predicted Effect probably benign
Transcript: ENSMUST00000150096
SMART Domains Protein: ENSMUSP00000117313
Gene: ENSMUSG00000033295

DomainStartEndE-ValueType
FN3 14 66 2.7e1 SMART
FN3 82 165 5.73e-11 SMART
FN3 180 259 4.06e-11 SMART
FN3 275 372 6.69e-12 SMART
FN3 385 461 2.83e-1 SMART
coiled coil region 527 556 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
PTPc 735 993 1.12e-138 SMART
PTPc 1022 1284 3.4e-129 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females have premature involution of the mammary glands leading to an inability to feed pups. Other characteristics of null mice include defective nerve regeneration and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 C T 3: 37,065,256 T162I probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Amn1 T C 6: 149,166,894 I205M possibly damaging Het
Ankrd50 A C 3: 38,456,185 S678A probably damaging Het
Atg13 G A 2: 91,692,466 R78* probably null Het
Bmper T G 9: 23,373,861 F235L probably benign Het
Btn2a2 C T 13: 23,482,875 V187I probably benign Het
Cabs1 G A 5: 87,979,633 V48I probably benign Het
Cacnb3 A G 15: 98,641,617 I212V probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cep162 T C 9: 87,206,895 E978G probably damaging Het
Cmya5 A T 13: 93,063,485 L3445Q probably damaging Het
Cntrl T A 2: 35,148,899 L1067* probably null Het
Cyp20a1 G A 1: 60,379,387 V329I probably benign Het
Cyp2d11 A T 15: 82,390,511 N288K probably benign Het
D430041D05Rik T G 2: 104,255,409 T932P probably damaging Het
Dlk1 T A 12: 109,455,521 C54S probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Entpd6 T A 2: 150,770,383 F416L probably damaging Het
Evx1 A G 6: 52,316,617 T257A probably benign Het
Fpr-rs3 A T 17: 20,624,334 S182T probably damaging Het
Glra3 A T 8: 55,940,901 I16F probably benign Het
Gm11437 C A 11: 84,152,687 L259F possibly damaging Het
Gorasp1 A T 9: 119,927,958 L386Q probably damaging Het
Gpsm1 T C 2: 26,340,562 V508A possibly damaging Het
Gstm1 T A 3: 108,012,736 I180F probably benign Het
Hc T C 2: 34,994,995 D1400G probably benign Het
Lrp2 A G 2: 69,464,708 V3422A possibly damaging Het
Map3k4 A G 17: 12,247,308 V1128A possibly damaging Het
Mboat2 G C 12: 24,957,573 V363L probably benign Het
Mgat3 A G 15: 80,211,610 I213V possibly damaging Het
Mgat3 A G 15: 80,212,454 N494S probably damaging Het
Mtf2 A T 5: 108,106,610 T426S possibly damaging Het
Muc3a T C 5: 137,210,564 I151V probably benign Het
Myh6 T C 14: 54,953,762 E874G probably damaging Het
Myo15 G A 11: 60,498,366 G2030R probably damaging Het
Ncdn T C 4: 126,747,228 Y493C probably damaging Het
Ncoa6 A G 2: 155,421,192 F441L probably damaging Het
Ndc80 A T 17: 71,521,108 S75T possibly damaging Het
Nf1 T C 11: 79,473,456 F1571L possibly damaging Het
Nme8 A G 13: 19,652,299 F236L probably damaging Het
Nsmce4a C A 7: 130,537,048 V289L probably damaging Het
Ntrk2 A T 13: 59,060,242 D634V probably damaging Het
Pcsk6 G C 7: 65,970,592 E479Q probably damaging Het
Pkd1 A G 17: 24,593,577 Q3828R probably damaging Het
Ptov1 T A 7: 44,864,665 T295S probably damaging Het
Rbm6 T A 9: 107,852,666 H129L probably damaging Het
Rbm8a2 A G 1: 175,978,689 I74T possibly damaging Het
Ret A G 6: 118,197,118 S6P possibly damaging Het
Rspo3 A T 10: 29,500,068 C70* probably null Het
Sike1 C A 3: 103,001,790 A202D possibly damaging Het
Slc9a3r2 A G 17: 24,641,971 V88A probably damaging Het
Slco4c1 G T 1: 96,832,110 P499H probably damaging Het
Smg1 A G 7: 118,195,133 probably benign Het
Tmem135 A G 7: 89,305,515 V98A probably benign Het
Tor4a T A 2: 25,195,906 probably null Het
Txlna A G 4: 129,630,373 F397S probably damaging Het
Tyk2 A G 9: 21,115,744 I581T probably benign Het
Unc13a C T 8: 71,662,514 D164N probably benign Het
Vwa3b T C 1: 37,114,583 I502T probably damaging Het
Xrcc6 A G 15: 82,029,218 T6A probably benign Het
Zfp524 T C 7: 5,018,433 V320A probably benign Het
Other mutations in Ptprf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ptprf APN 4 118223220 splice site probably benign
IGL01337:Ptprf APN 4 118236291 missense probably damaging 1.00
IGL01482:Ptprf APN 4 118212454 missense probably damaging 1.00
IGL01743:Ptprf APN 4 118248898 critical splice donor site probably null
IGL01987:Ptprf APN 4 118277370 missense probably benign
IGL02189:Ptprf APN 4 118213642 splice site probably benign
IGL03067:Ptprf APN 4 118210713 missense possibly damaging 0.67
PIT4677001:Ptprf UTSW 4 118213612 missense probably damaging 1.00
R0382:Ptprf UTSW 4 118223394 splice site probably benign
R0788:Ptprf UTSW 4 118226466 missense probably damaging 0.97
R1164:Ptprf UTSW 4 118257492 missense probably damaging 1.00
R1478:Ptprf UTSW 4 118212105 nonsense probably null
R1483:Ptprf UTSW 4 118235964 missense possibly damaging 0.81
R1611:Ptprf UTSW 4 118236233 missense probably benign 0.34
R1721:Ptprf UTSW 4 118224899 missense possibly damaging 0.56
R1817:Ptprf UTSW 4 118223265 missense probably benign 0.02
R1818:Ptprf UTSW 4 118209871 missense probably damaging 1.00
R1860:Ptprf UTSW 4 118223932 missense probably damaging 1.00
R2208:Ptprf UTSW 4 118269172 splice site probably benign
R2406:Ptprf UTSW 4 118269304 missense possibly damaging 0.62
R2912:Ptprf UTSW 4 118248980 missense probably damaging 0.98
R3111:Ptprf UTSW 4 118211432 missense probably damaging 1.00
R3498:Ptprf UTSW 4 118224930 missense probably damaging 0.99
R3499:Ptprf UTSW 4 118224930 missense probably damaging 0.99
R3615:Ptprf UTSW 4 118237883 missense probably benign 0.04
R3616:Ptprf UTSW 4 118237883 missense probably benign 0.04
R4038:Ptprf UTSW 4 118257608 missense probably damaging 1.00
R4243:Ptprf UTSW 4 118226452 critical splice donor site probably null
R4260:Ptprf UTSW 4 118226083 missense possibly damaging 0.64
R4693:Ptprf UTSW 4 118211022 missense probably benign 0.16
R4726:Ptprf UTSW 4 118212217 missense possibly damaging 0.86
R4746:Ptprf UTSW 4 118225039 missense possibly damaging 0.83
R4802:Ptprf UTSW 4 118210329 intron probably benign
R4857:Ptprf UTSW 4 118217197 splice site probably benign
R5071:Ptprf UTSW 4 118211999 missense probably damaging 1.00
R5221:Ptprf UTSW 4 118225108 missense probably benign 0.00
R5327:Ptprf UTSW 4 118236389 missense probably damaging 1.00
R5336:Ptprf UTSW 4 118235634 missense probably damaging 1.00
R5373:Ptprf UTSW 4 118226041 missense possibly damaging 0.93
R5555:Ptprf UTSW 4 118224924 missense probably damaging 1.00
R5693:Ptprf UTSW 4 118236177 nonsense probably null
R5860:Ptprf UTSW 4 118211289 intron probably benign
R5869:Ptprf UTSW 4 118210382 missense probably damaging 1.00
R5890:Ptprf UTSW 4 118224735 missense probably benign
R5932:Ptprf UTSW 4 118211767 missense probably benign 0.10
R6028:Ptprf UTSW 4 118213629 missense probably benign 0.01
R6030:Ptprf UTSW 4 118211048 missense probably benign 0.19
R6030:Ptprf UTSW 4 118211048 missense probably benign 0.19
R6088:Ptprf UTSW 4 118210755 missense possibly damaging 0.68
R6089:Ptprf UTSW 4 118211084 missense probably damaging 0.99
R6108:Ptprf UTSW 4 118223256 missense probably benign 0.01
R6320:Ptprf UTSW 4 118212814 missense probably benign
R6741:Ptprf UTSW 4 118223368 missense probably benign 0.00
R6744:Ptprf UTSW 4 118236365 missense probably benign 0.00
R6750:Ptprf UTSW 4 118231731 missense probably benign 0.03
R6906:Ptprf UTSW 4 118269277 missense possibly damaging 0.95
R7021:Ptprf UTSW 4 118223904 missense probably benign 0.00
R7153:Ptprf UTSW 4 118231543 missense probably damaging 1.00
R7326:Ptprf UTSW 4 118231669 missense probably damaging 0.99
R7337:Ptprf UTSW 4 118211125 missense probably damaging 0.99
R7374:Ptprf UTSW 4 118257492 missense probably damaging 1.00
R7375:Ptprf UTSW 4 118212814 missense probably benign
R7399:Ptprf UTSW 4 118226523 missense probably benign 0.28
R7417:Ptprf UTSW 4 118212172 missense probably damaging 1.00
R7448:Ptprf UTSW 4 118235667 missense probably benign 0.03
R7530:Ptprf UTSW 4 118212748 missense probably damaging 1.00
X0067:Ptprf UTSW 4 118236026 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GATTTTGAGGAAAGCCACTGGG -3'
(R):5'- TCGCTGCCTACACCACTAAG -3'

Sequencing Primer
(F):5'- AAACTCTTCTCCTGGGCCAG -3'
(R):5'- CACCACTAAGGGGGATGGTGC -3'
Posted On2016-08-04