Incidental Mutation 'R5356:Ret'
ID424099
Institutional Source Beutler Lab
Gene Symbol Ret
Ensembl Gene ENSMUSG00000030110
Gene Nameret proto-oncogene
Synonymsc-Ret, RET9, RET51
MMRRC Submission 042935-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.859) question?
Stock #R5356 (G1)
Quality Score135
Status Not validated
Chromosome6
Chromosomal Location118151745-118197718 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118197118 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 6 (S6P)
Ref Sequence ENSEMBL: ENSMUSP00000086169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032201] [ENSMUST00000088790]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032201
AA Change: S6P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032201
Gene: ENSMUSG00000030110
AA Change: S6P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 191 271 1.11e-1 SMART
low complexity region 638 656 N/A INTRINSIC
TyrKc 725 1006 3.58e-148 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000088790
AA Change: S6P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000086169
Gene: ENSMUSG00000030110
AA Change: S6P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 191 271 1.11e-1 SMART
low complexity region 638 656 N/A INTRINSIC
TyrKc 725 1006 3.58e-148 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a member of the cadherin superfamily, encodes one of the receptor tyrosine kinases, which are cell-surface molecules that transduce signals for cell growth and differentiation. This gene plays a crucial role in neural crest development, and it can undergo oncogenic activation in vivo and in vitro by cytogenetic rearrangement. Mutations in this gene are associated with the disorders multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, Hirschsprung disease, and medullary thyroid carcinoma. Two transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some point mutations or knock-out alleles exhibit premature lethality, defects in neurogenesis, and abnormal kidney, ureter, ovary, muscle, and intestine morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 C T 3: 37,065,256 T162I probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Amn1 T C 6: 149,166,894 I205M possibly damaging Het
Ankrd50 A C 3: 38,456,185 S678A probably damaging Het
Atg13 G A 2: 91,692,466 R78* probably null Het
Bmper T G 9: 23,373,861 F235L probably benign Het
Btn2a2 C T 13: 23,482,875 V187I probably benign Het
Cabs1 G A 5: 87,979,633 V48I probably benign Het
Cacnb3 A G 15: 98,641,617 I212V probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cep162 T C 9: 87,206,895 E978G probably damaging Het
Cmya5 A T 13: 93,063,485 L3445Q probably damaging Het
Cntrl T A 2: 35,148,899 L1067* probably null Het
Cyp20a1 G A 1: 60,379,387 V329I probably benign Het
Cyp2d11 A T 15: 82,390,511 N288K probably benign Het
D430041D05Rik T G 2: 104,255,409 T932P probably damaging Het
Dlk1 T A 12: 109,455,521 C54S probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Entpd6 T A 2: 150,770,383 F416L probably damaging Het
Evx1 A G 6: 52,316,617 T257A probably benign Het
Fpr-rs3 A T 17: 20,624,334 S182T probably damaging Het
Glra3 A T 8: 55,940,901 I16F probably benign Het
Gm11437 C A 11: 84,152,687 L259F possibly damaging Het
Gorasp1 A T 9: 119,927,958 L386Q probably damaging Het
Gpsm1 T C 2: 26,340,562 V508A possibly damaging Het
Gstm1 T A 3: 108,012,736 I180F probably benign Het
Hc T C 2: 34,994,995 D1400G probably benign Het
Lrp2 A G 2: 69,464,708 V3422A possibly damaging Het
Map3k4 A G 17: 12,247,308 V1128A possibly damaging Het
Mboat2 G C 12: 24,957,573 V363L probably benign Het
Mgat3 A G 15: 80,211,610 I213V possibly damaging Het
Mgat3 A G 15: 80,212,454 N494S probably damaging Het
Mtf2 A T 5: 108,106,610 T426S possibly damaging Het
Muc3a T C 5: 137,210,564 I151V probably benign Het
Myh6 T C 14: 54,953,762 E874G probably damaging Het
Myo15 G A 11: 60,498,366 G2030R probably damaging Het
Ncdn T C 4: 126,747,228 Y493C probably damaging Het
Ncoa6 A G 2: 155,421,192 F441L probably damaging Het
Ndc80 A T 17: 71,521,108 S75T possibly damaging Het
Nf1 T C 11: 79,473,456 F1571L possibly damaging Het
Nme8 A G 13: 19,652,299 F236L probably damaging Het
Nsmce4a C A 7: 130,537,048 V289L probably damaging Het
Ntrk2 A T 13: 59,060,242 D634V probably damaging Het
Pcsk6 G C 7: 65,970,592 E479Q probably damaging Het
Pkd1 A G 17: 24,593,577 Q3828R probably damaging Het
Ptov1 T A 7: 44,864,665 T295S probably damaging Het
Ptprf A G 4: 118,226,338 M824T probably benign Het
Rbm6 T A 9: 107,852,666 H129L probably damaging Het
Rbm8a2 A G 1: 175,978,689 I74T possibly damaging Het
Rspo3 A T 10: 29,500,068 C70* probably null Het
Sike1 C A 3: 103,001,790 A202D possibly damaging Het
Slc9a3r2 A G 17: 24,641,971 V88A probably damaging Het
Slco4c1 G T 1: 96,832,110 P499H probably damaging Het
Smg1 A G 7: 118,195,133 probably benign Het
Tmem135 A G 7: 89,305,515 V98A probably benign Het
Tor4a T A 2: 25,195,906 probably null Het
Txlna A G 4: 129,630,373 F397S probably damaging Het
Tyk2 A G 9: 21,115,744 I581T probably benign Het
Unc13a C T 8: 71,662,514 D164N probably benign Het
Vwa3b T C 1: 37,114,583 I502T probably damaging Het
Xrcc6 A G 15: 82,029,218 T6A probably benign Het
Zfp524 T C 7: 5,018,433 V320A probably benign Het
Other mutations in Ret
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02255:Ret APN 6 118175120 splice site probably null
IGL02445:Ret APN 6 118181899 missense probably damaging 0.98
IGL02754:Ret APN 6 118176252 missense probably benign 0.03
IGL02828:Ret APN 6 118176207 missense probably benign 0.00
IGL03058:Ret APN 6 118175067 missense probably damaging 1.00
PIT4151001:Ret UTSW 6 118164741 missense probably benign 0.04
R0126:Ret UTSW 6 118165995 splice site probably benign
R0555:Ret UTSW 6 118178610 missense probably damaging 0.96
R1168:Ret UTSW 6 118173558 missense possibly damaging 0.94
R1829:Ret UTSW 6 118153951 missense probably damaging 0.99
R2020:Ret UTSW 6 118180382 missense possibly damaging 0.63
R4082:Ret UTSW 6 118153966 missense possibly damaging 0.81
R4732:Ret UTSW 6 118163193 missense possibly damaging 0.77
R4733:Ret UTSW 6 118163193 missense possibly damaging 0.77
R5401:Ret UTSW 6 118181975 missense probably benign 0.05
R5572:Ret UTSW 6 118155431 missense probably damaging 1.00
R5669:Ret UTSW 6 118184243 missense probably benign
R6058:Ret UTSW 6 118179319 missense probably benign
R6087:Ret UTSW 6 118176291 missense possibly damaging 0.53
R6412:Ret UTSW 6 118184284 missense probably benign 0.00
R6457:Ret UTSW 6 118173621 missense probably benign 0.01
R6884:Ret UTSW 6 118155401 missense probably damaging 1.00
R7035:Ret UTSW 6 118163286 missense probably damaging 1.00
R7112:Ret UTSW 6 118197102 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCTTGGGATGTTCAGCTGC -3'
(R):5'- AGGTCTCTCATCAGTACCGCAAC -3'

Sequencing Primer
(F):5'- TCGCAACTCGCACGGAC -3'
(R):5'- GAGCCGTGCAAGCAACAGC -3'
Posted On2016-08-04