Incidental Mutation 'R5356:Zfp524'
ID424101
Institutional Source Beutler Lab
Gene Symbol Zfp524
Ensembl Gene ENSMUSG00000051184
Gene Namezinc finger protein 524
Synonyms2300009P13Rik, 0610012F07Rik
MMRRC Submission 042935-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R5356 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location5014415-5018488 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5018433 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 320 (V320A)
Ref Sequence ENSEMBL: ENSMUSP00000147095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076251] [ENSMUST00000077385] [ENSMUST00000085427] [ENSMUST00000086349] [ENSMUST00000165320] [ENSMUST00000167804] [ENSMUST00000207030] [ENSMUST00000207050] [ENSMUST00000207412] [ENSMUST00000207901] [ENSMUST00000207946] [ENSMUST00000208728] [ENSMUST00000209030] [ENSMUST00000209060]
Predicted Effect probably benign
Transcript: ENSMUST00000076251
SMART Domains Protein: ENSMUSP00000075601
Gene: ENSMUSG00000074405

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 62 82 N/A INTRINSIC
low complexity region 120 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
ZnF_C2H2 220 242 1.28e-3 SMART
ZnF_C2H2 248 270 5.5e-3 SMART
low complexity region 274 286 N/A INTRINSIC
low complexity region 294 324 N/A INTRINSIC
ZnF_C2H2 350 372 8.81e-2 SMART
ZnF_C2H2 378 400 6.08e-5 SMART
ZnF_C2H2 407 429 1.79e-2 SMART
ZnF_C2H2 439 461 1.92e-2 SMART
low complexity region 478 495 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 523 542 N/A INTRINSIC
ZnF_C2H2 546 568 4.47e-3 SMART
ZnF_C2H2 574 596 5.42e-2 SMART
ZnF_C2H2 602 624 1.72e-4 SMART
low complexity region 628 660 N/A INTRINSIC
ZnF_C2H2 664 686 5.34e-1 SMART
ZnF_C2H2 692 714 2.82e0 SMART
low complexity region 725 745 N/A INTRINSIC
low complexity region 750 770 N/A INTRINSIC
low complexity region 772 788 N/A INTRINSIC
ZnF_C2H2 791 813 1.64e-1 SMART
ZnF_C2H2 819 841 9.3e-1 SMART
ZnF_C2H2 847 869 2.95e-3 SMART
ZnF_C2H2 875 897 3.83e-2 SMART
ZnF_C2H2 903 925 2.05e-2 SMART
ZnF_C2H2 931 953 1.18e-2 SMART
ZnF_C2H2 959 981 1.36e-2 SMART
ZnF_C2H2 988 1010 5.06e-2 SMART
ZnF_C2H2 1016 1038 4.72e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077385
SMART Domains Protein: ENSMUSP00000076603
Gene: ENSMUSG00000061374

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
ZnF_C2H2 29 51 5.99e-4 SMART
ZnF_C2H2 57 79 6.32e-3 SMART
ZnF_C2H2 85 107 1.36e-2 SMART
ZnF_C2H2 113 136 4.72e-2 SMART
low complexity region 140 177 N/A INTRINSIC
ZnF_C2H2 204 226 1.02e1 SMART
ZnF_C2H2 232 254 9.44e-2 SMART
low complexity region 322 332 N/A INTRINSIC
ZnF_C2H2 336 357 2.12e1 SMART
ZnF_C2H2 363 386 2.45e0 SMART
low complexity region 404 414 N/A INTRINSIC
ZnF_C2H2 418 440 8.94e-3 SMART
ZnF_C2H2 446 468 4.05e-1 SMART
ZnF_C2H2 474 496 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085427
SMART Domains Protein: ENSMUSP00000082550
Gene: ENSMUSG00000074405

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 62 82 N/A INTRINSIC
low complexity region 120 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
ZnF_C2H2 220 242 1.28e-3 SMART
ZnF_C2H2 248 270 5.5e-3 SMART
low complexity region 274 286 N/A INTRINSIC
low complexity region 294 324 N/A INTRINSIC
ZnF_C2H2 350 372 8.81e-2 SMART
ZnF_C2H2 378 400 6.08e-5 SMART
ZnF_C2H2 407 429 1.79e-2 SMART
ZnF_C2H2 439 461 1.92e-2 SMART
low complexity region 478 495 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 523 542 N/A INTRINSIC
ZnF_C2H2 546 568 4.47e-3 SMART
ZnF_C2H2 574 596 5.42e-2 SMART
ZnF_C2H2 602 624 1.72e-4 SMART
low complexity region 628 660 N/A INTRINSIC
ZnF_C2H2 664 686 5.34e-1 SMART
ZnF_C2H2 692 714 2.82e0 SMART
low complexity region 725 745 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086349
AA Change: V320A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083533
Gene: ENSMUSG00000051184
AA Change: V320A

DomainStartEndE-ValueType
AT_hook 29 41 1.53e2 SMART
AT_hook 51 63 1.09e0 SMART
ZnF_C2H2 109 131 1.16e-1 SMART
ZnF_C2H2 137 159 1.56e-2 SMART
ZnF_C2H2 165 187 4.4e-2 SMART
ZnF_C2H2 193 216 7.26e-3 SMART
low complexity region 272 287 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165320
SMART Domains Protein: ENSMUSP00000128105
Gene: ENSMUSG00000061374

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
ZnF_C2H2 29 51 5.99e-4 SMART
ZnF_C2H2 57 79 6.32e-3 SMART
ZnF_C2H2 85 107 1.36e-2 SMART
ZnF_C2H2 113 136 4.72e-2 SMART
low complexity region 140 177 N/A INTRINSIC
ZnF_C2H2 204 226 1.02e1 SMART
ZnF_C2H2 232 254 9.44e-2 SMART
low complexity region 322 332 N/A INTRINSIC
ZnF_C2H2 336 357 2.12e1 SMART
ZnF_C2H2 363 386 2.45e0 SMART
low complexity region 404 414 N/A INTRINSIC
ZnF_C2H2 418 440 8.94e-3 SMART
ZnF_C2H2 446 468 4.05e-1 SMART
ZnF_C2H2 474 496 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167804
SMART Domains Protein: ENSMUSP00000126765
Gene: ENSMUSG00000061374

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
ZnF_C2H2 29 51 5.99e-4 SMART
ZnF_C2H2 57 79 6.32e-3 SMART
ZnF_C2H2 85 107 1.36e-2 SMART
ZnF_C2H2 113 136 4.72e-2 SMART
low complexity region 140 177 N/A INTRINSIC
ZnF_C2H2 204 226 1.02e1 SMART
ZnF_C2H2 232 254 9.44e-2 SMART
low complexity region 322 332 N/A INTRINSIC
ZnF_C2H2 336 357 2.12e1 SMART
ZnF_C2H2 363 386 2.45e0 SMART
low complexity region 404 414 N/A INTRINSIC
ZnF_C2H2 418 440 8.94e-3 SMART
ZnF_C2H2 446 468 4.05e-1 SMART
ZnF_C2H2 474 496 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207030
Predicted Effect probably benign
Transcript: ENSMUST00000207050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207362
Predicted Effect probably benign
Transcript: ENSMUST00000207412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207845
Predicted Effect probably benign
Transcript: ENSMUST00000207901
AA Change: V320A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207946
Predicted Effect probably benign
Transcript: ENSMUST00000208728
Predicted Effect probably benign
Transcript: ENSMUST00000209030
AA Change: V320A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000209060
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 C T 3: 37,065,256 T162I probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Amn1 T C 6: 149,166,894 I205M possibly damaging Het
Ankrd50 A C 3: 38,456,185 S678A probably damaging Het
Atg13 G A 2: 91,692,466 R78* probably null Het
Bmper T G 9: 23,373,861 F235L probably benign Het
Btn2a2 C T 13: 23,482,875 V187I probably benign Het
Cabs1 G A 5: 87,979,633 V48I probably benign Het
Cacnb3 A G 15: 98,641,617 I212V probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cep162 T C 9: 87,206,895 E978G probably damaging Het
Cmya5 A T 13: 93,063,485 L3445Q probably damaging Het
Cntrl T A 2: 35,148,899 L1067* probably null Het
Cyp20a1 G A 1: 60,379,387 V329I probably benign Het
Cyp2d11 A T 15: 82,390,511 N288K probably benign Het
D430041D05Rik T G 2: 104,255,409 T932P probably damaging Het
Dlk1 T A 12: 109,455,521 C54S probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Entpd6 T A 2: 150,770,383 F416L probably damaging Het
Evx1 A G 6: 52,316,617 T257A probably benign Het
Fpr-rs3 A T 17: 20,624,334 S182T probably damaging Het
Glra3 A T 8: 55,940,901 I16F probably benign Het
Gm11437 C A 11: 84,152,687 L259F possibly damaging Het
Gorasp1 A T 9: 119,927,958 L386Q probably damaging Het
Gpsm1 T C 2: 26,340,562 V508A possibly damaging Het
Gstm1 T A 3: 108,012,736 I180F probably benign Het
Hc T C 2: 34,994,995 D1400G probably benign Het
Lrp2 A G 2: 69,464,708 V3422A possibly damaging Het
Map3k4 A G 17: 12,247,308 V1128A possibly damaging Het
Mboat2 G C 12: 24,957,573 V363L probably benign Het
Mgat3 A G 15: 80,211,610 I213V possibly damaging Het
Mgat3 A G 15: 80,212,454 N494S probably damaging Het
Mtf2 A T 5: 108,106,610 T426S possibly damaging Het
Muc3a T C 5: 137,210,564 I151V probably benign Het
Myh6 T C 14: 54,953,762 E874G probably damaging Het
Myo15 G A 11: 60,498,366 G2030R probably damaging Het
Ncdn T C 4: 126,747,228 Y493C probably damaging Het
Ncoa6 A G 2: 155,421,192 F441L probably damaging Het
Ndc80 A T 17: 71,521,108 S75T possibly damaging Het
Nf1 T C 11: 79,473,456 F1571L possibly damaging Het
Nme8 A G 13: 19,652,299 F236L probably damaging Het
Nsmce4a C A 7: 130,537,048 V289L probably damaging Het
Ntrk2 A T 13: 59,060,242 D634V probably damaging Het
Pcsk6 G C 7: 65,970,592 E479Q probably damaging Het
Pkd1 A G 17: 24,593,577 Q3828R probably damaging Het
Ptov1 T A 7: 44,864,665 T295S probably damaging Het
Ptprf A G 4: 118,226,338 M824T probably benign Het
Rbm6 T A 9: 107,852,666 H129L probably damaging Het
Rbm8a2 A G 1: 175,978,689 I74T possibly damaging Het
Ret A G 6: 118,197,118 S6P possibly damaging Het
Rspo3 A T 10: 29,500,068 C70* probably null Het
Sike1 C A 3: 103,001,790 A202D possibly damaging Het
Slc9a3r2 A G 17: 24,641,971 V88A probably damaging Het
Slco4c1 G T 1: 96,832,110 P499H probably damaging Het
Smg1 A G 7: 118,195,133 probably benign Het
Tmem135 A G 7: 89,305,515 V98A probably benign Het
Tor4a T A 2: 25,195,906 probably null Het
Txlna A G 4: 129,630,373 F397S probably damaging Het
Tyk2 A G 9: 21,115,744 I581T probably benign Het
Unc13a C T 8: 71,662,514 D164N probably benign Het
Vwa3b T C 1: 37,114,583 I502T probably damaging Het
Xrcc6 A G 15: 82,029,218 T6A probably benign Het
Other mutations in Zfp524
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02061:Zfp524 APN 7 5017872 missense probably damaging 1.00
IGL02433:Zfp524 APN 7 5018092 missense possibly damaging 0.81
IGL02644:Zfp524 APN 7 5017480 missense probably damaging 0.99
R2211:Zfp524 UTSW 7 5017919 missense probably damaging 1.00
R3755:Zfp524 UTSW 7 5017885 missense probably damaging 1.00
R4579:Zfp524 UTSW 7 5018348 missense probably benign
R5022:Zfp524 UTSW 7 5018417 missense probably benign
R5580:Zfp524 UTSW 7 5018417 missense probably benign
R7076:Zfp524 UTSW 7 5017896 missense possibly damaging 0.72
R7199:Zfp524 UTSW 7 5017884 missense probably damaging 0.98
R7471:Zfp524 UTSW 7 5018201 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTGAAGGAAAGGAGCCTACTTG -3'
(R):5'- GGGCAAAGGCTTGTTCCAAG -3'

Sequencing Primer
(F):5'- ACTTGGCCCATATCCTCCAC -3'
(R):5'- TCTTTGGCACCAAGCTAGG -3'
Posted On2016-08-04