Incidental Mutation 'R5356:Bmper'
ID424110
Institutional Source Beutler Lab
Gene Symbol Bmper
Ensembl Gene ENSMUSG00000031963
Gene NameBMP-binding endothelial regulator
SynonymsCV-2, Crim3, 3110056H04Rik, crossveinless-2, Cv2
MMRRC Submission 042935-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5356 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location23223076-23485200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 23373861 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 235 (F235L)
Ref Sequence ENSEMBL: ENSMUSP00000071872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071982]
Predicted Effect probably benign
Transcript: ENSMUST00000071982
AA Change: F235L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000071872
Gene: ENSMUSG00000031963
AA Change: F235L

DomainStartEndE-ValueType
VWC 50 105 1.57e-2 SMART
VWC 108 163 1.89e-1 SMART
VWC 166 224 7.27e-7 SMART
VWC 238 289 3.34e-6 SMART
VWC 301 357 1.7e-7 SMART
VWD 355 513 3.75e-41 SMART
C8 553 625 1.07e-14 SMART
Pfam:TIL 629 682 2.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214050
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted protein that contains five Von Willebrand factor type C domains and a Von Willebrand factor type D domain and a trypsin inhibitory-like domain. The encoded protein binds to bone morphogenetic proteins (BMP) and regulates their activity. Mutation of the related gene in humans causes diaphanospondylodysostosis. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a knock-out mutation exhibit neonatal lethality associated with abnormal lung and skeleton development. Mice heterozygous for a null allele exhibit abnromal lung development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 C T 3: 37,065,256 T162I probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Amn1 T C 6: 149,166,894 I205M possibly damaging Het
Ankrd50 A C 3: 38,456,185 S678A probably damaging Het
Atg13 G A 2: 91,692,466 R78* probably null Het
Btn2a2 C T 13: 23,482,875 V187I probably benign Het
Cabs1 G A 5: 87,979,633 V48I probably benign Het
Cacnb3 A G 15: 98,641,617 I212V probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cep162 T C 9: 87,206,895 E978G probably damaging Het
Cmya5 A T 13: 93,063,485 L3445Q probably damaging Het
Cntrl T A 2: 35,148,899 L1067* probably null Het
Cyp20a1 G A 1: 60,379,387 V329I probably benign Het
Cyp2d11 A T 15: 82,390,511 N288K probably benign Het
D430041D05Rik T G 2: 104,255,409 T932P probably damaging Het
Dlk1 T A 12: 109,455,521 C54S probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Entpd6 T A 2: 150,770,383 F416L probably damaging Het
Evx1 A G 6: 52,316,617 T257A probably benign Het
Fpr-rs3 A T 17: 20,624,334 S182T probably damaging Het
Glra3 A T 8: 55,940,901 I16F probably benign Het
Gm11437 C A 11: 84,152,687 L259F possibly damaging Het
Gorasp1 A T 9: 119,927,958 L386Q probably damaging Het
Gpsm1 T C 2: 26,340,562 V508A possibly damaging Het
Gstm1 T A 3: 108,012,736 I180F probably benign Het
Hc T C 2: 34,994,995 D1400G probably benign Het
Lrp2 A G 2: 69,464,708 V3422A possibly damaging Het
Map3k4 A G 17: 12,247,308 V1128A possibly damaging Het
Mboat2 G C 12: 24,957,573 V363L probably benign Het
Mgat3 A G 15: 80,211,610 I213V possibly damaging Het
Mgat3 A G 15: 80,212,454 N494S probably damaging Het
Mtf2 A T 5: 108,106,610 T426S possibly damaging Het
Muc3a T C 5: 137,210,564 I151V probably benign Het
Myh6 T C 14: 54,953,762 E874G probably damaging Het
Myo15 G A 11: 60,498,366 G2030R probably damaging Het
Ncdn T C 4: 126,747,228 Y493C probably damaging Het
Ncoa6 A G 2: 155,421,192 F441L probably damaging Het
Ndc80 A T 17: 71,521,108 S75T possibly damaging Het
Nf1 T C 11: 79,473,456 F1571L possibly damaging Het
Nme8 A G 13: 19,652,299 F236L probably damaging Het
Nsmce4a C A 7: 130,537,048 V289L probably damaging Het
Ntrk2 A T 13: 59,060,242 D634V probably damaging Het
Pcsk6 G C 7: 65,970,592 E479Q probably damaging Het
Pkd1 A G 17: 24,593,577 Q3828R probably damaging Het
Ptov1 T A 7: 44,864,665 T295S probably damaging Het
Ptprf A G 4: 118,226,338 M824T probably benign Het
Rbm6 T A 9: 107,852,666 H129L probably damaging Het
Rbm8a2 A G 1: 175,978,689 I74T possibly damaging Het
Ret A G 6: 118,197,118 S6P possibly damaging Het
Rspo3 A T 10: 29,500,068 C70* probably null Het
Sike1 C A 3: 103,001,790 A202D possibly damaging Het
Slc9a3r2 A G 17: 24,641,971 V88A probably damaging Het
Slco4c1 G T 1: 96,832,110 P499H probably damaging Het
Smg1 A G 7: 118,195,133 probably benign Het
Tmem135 A G 7: 89,305,515 V98A probably benign Het
Tor4a T A 2: 25,195,906 probably null Het
Txlna A G 4: 129,630,373 F397S probably damaging Het
Tyk2 A G 9: 21,115,744 I581T probably benign Het
Unc13a C T 8: 71,662,514 D164N probably benign Het
Vwa3b T C 1: 37,114,583 I502T probably damaging Het
Xrcc6 A G 15: 82,029,218 T6A probably benign Het
Zfp524 T C 7: 5,018,433 V320A probably benign Het
Other mutations in Bmper
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Bmper APN 9 23406527 missense probably damaging 1.00
IGL00576:Bmper APN 9 23406603 missense probably damaging 1.00
IGL01115:Bmper APN 9 23399689 intron probably benign
IGL01978:Bmper APN 9 23381441 missense probably damaging 1.00
IGL02950:Bmper APN 9 23399494 missense probably damaging 1.00
IGL03193:Bmper APN 9 23366248 missense possibly damaging 0.46
PIT4469001:Bmper UTSW 9 23406549 missense probably benign 0.00
PIT4531001:Bmper UTSW 9 23224817 missense possibly damaging 0.90
R0047:Bmper UTSW 9 23406686 missense probably damaging 1.00
R0047:Bmper UTSW 9 23406686 missense probably damaging 1.00
R0173:Bmper UTSW 9 23224829 missense probably benign 0.02
R0504:Bmper UTSW 9 23406687 missense probably damaging 1.00
R0550:Bmper UTSW 9 23373885 missense probably benign 0.01
R0722:Bmper UTSW 9 23373928 missense probably benign 0.00
R2254:Bmper UTSW 9 23381463 missense possibly damaging 0.81
R2255:Bmper UTSW 9 23381463 missense possibly damaging 0.81
R2863:Bmper UTSW 9 23483941 missense probably benign
R2865:Bmper UTSW 9 23483941 missense probably benign
R3841:Bmper UTSW 9 23473431 splice site probably null
R4056:Bmper UTSW 9 23399629 missense probably benign
R4105:Bmper UTSW 9 23224763 missense probably benign 0.00
R4108:Bmper UTSW 9 23224763 missense probably benign 0.00
R4352:Bmper UTSW 9 23483952 missense probably benign
R4824:Bmper UTSW 9 23223660 missense possibly damaging 0.77
R4909:Bmper UTSW 9 23377725 missense probably benign 0.07
R5379:Bmper UTSW 9 23297224 missense probably benign 0.42
R5666:Bmper UTSW 9 23473463 missense probably damaging 1.00
R5670:Bmper UTSW 9 23473463 missense probably damaging 1.00
R5883:Bmper UTSW 9 23406674 missense probably benign 0.28
R5963:Bmper UTSW 9 23375593 missense probably benign 0.03
R6312:Bmper UTSW 9 23406791 missense possibly damaging 0.46
R6768:Bmper UTSW 9 23381453 missense probably damaging 1.00
R6897:Bmper UTSW 9 23373929 missense probably benign 0.01
R6907:Bmper UTSW 9 23399572 missense probably damaging 1.00
R7220:Bmper UTSW 9 23399355 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTGGTAGACCTGACCCAAG -3'
(R):5'- TGATCATATTCTTCAGATGCCACCAG -3'

Sequencing Primer
(F):5'- AGACCTGACCCAAGGCTCTATTTTTG -3'
(R):5'- CAGCAACGGTTATTCCTGATAAGC -3'
Posted On2016-08-04