Incidental Mutation 'R5356:Rspo3'
ID424114
Institutional Source Beutler Lab
Gene Symbol Rspo3
Ensembl Gene ENSMUSG00000019880
Gene NameR-spondin 3
Synonyms2810459H04Rik, Thsd2, Cristin1
MMRRC Submission 042935-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5356 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location29452416-29535867 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 29500068 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 70 (C70*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092623]
Predicted Effect probably null
Transcript: ENSMUST00000092623
AA Change: C166*
SMART Domains Protein: ENSMUSP00000090287
Gene: ENSMUSG00000019880
AA Change: C166*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FU 35 86 4.74e-6 SMART
FU 92 135 3.79e-5 SMART
EGF 97 126 2.39e1 SMART
TSP1 150 207 1.56e-6 SMART
low complexity region 248 269 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000215256
AA Change: C70*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the R-spondin family. The encoded protein plays a role in the regulation of Wnt (wingless-type MMTV integration site family)/beta-catenin and Wnt/planar cell polarity (PCP) signaling pathways, which are involved in development, cell growth and disease pathogenesis. Genome-wide association studies suggest a correlation of this gene with bone mineral density and risk of fracture. This gene may be involved in tumor development. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, embryonic growth arrest, and impaired fetal placental vascular development. Mice homozygous for a conditional allele activated in limbs exhibit slight limb shortening. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 C T 3: 37,065,256 T162I probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Amn1 T C 6: 149,166,894 I205M possibly damaging Het
Ankrd50 A C 3: 38,456,185 S678A probably damaging Het
Atg13 G A 2: 91,692,466 R78* probably null Het
Bmper T G 9: 23,373,861 F235L probably benign Het
Btn2a2 C T 13: 23,482,875 V187I probably benign Het
Cabs1 G A 5: 87,979,633 V48I probably benign Het
Cacnb3 A G 15: 98,641,617 I212V probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cep162 T C 9: 87,206,895 E978G probably damaging Het
Cmya5 A T 13: 93,063,485 L3445Q probably damaging Het
Cntrl T A 2: 35,148,899 L1067* probably null Het
Cyp20a1 G A 1: 60,379,387 V329I probably benign Het
Cyp2d11 A T 15: 82,390,511 N288K probably benign Het
D430041D05Rik T G 2: 104,255,409 T932P probably damaging Het
Dlk1 T A 12: 109,455,521 C54S probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Entpd6 T A 2: 150,770,383 F416L probably damaging Het
Evx1 A G 6: 52,316,617 T257A probably benign Het
Fpr-rs3 A T 17: 20,624,334 S182T probably damaging Het
Glra3 A T 8: 55,940,901 I16F probably benign Het
Gm11437 C A 11: 84,152,687 L259F possibly damaging Het
Gorasp1 A T 9: 119,927,958 L386Q probably damaging Het
Gpsm1 T C 2: 26,340,562 V508A possibly damaging Het
Gstm1 T A 3: 108,012,736 I180F probably benign Het
Hc T C 2: 34,994,995 D1400G probably benign Het
Lrp2 A G 2: 69,464,708 V3422A possibly damaging Het
Map3k4 A G 17: 12,247,308 V1128A possibly damaging Het
Mboat2 G C 12: 24,957,573 V363L probably benign Het
Mgat3 A G 15: 80,211,610 I213V possibly damaging Het
Mgat3 A G 15: 80,212,454 N494S probably damaging Het
Mtf2 A T 5: 108,106,610 T426S possibly damaging Het
Muc3a T C 5: 137,210,564 I151V probably benign Het
Myh6 T C 14: 54,953,762 E874G probably damaging Het
Myo15 G A 11: 60,498,366 G2030R probably damaging Het
Ncdn T C 4: 126,747,228 Y493C probably damaging Het
Ncoa6 A G 2: 155,421,192 F441L probably damaging Het
Ndc80 A T 17: 71,521,108 S75T possibly damaging Het
Nf1 T C 11: 79,473,456 F1571L possibly damaging Het
Nme8 A G 13: 19,652,299 F236L probably damaging Het
Nsmce4a C A 7: 130,537,048 V289L probably damaging Het
Ntrk2 A T 13: 59,060,242 D634V probably damaging Het
Pcsk6 G C 7: 65,970,592 E479Q probably damaging Het
Pkd1 A G 17: 24,593,577 Q3828R probably damaging Het
Ptov1 T A 7: 44,864,665 T295S probably damaging Het
Ptprf A G 4: 118,226,338 M824T probably benign Het
Rbm6 T A 9: 107,852,666 H129L probably damaging Het
Rbm8a2 A G 1: 175,978,689 I74T possibly damaging Het
Ret A G 6: 118,197,118 S6P possibly damaging Het
Sike1 C A 3: 103,001,790 A202D possibly damaging Het
Slc9a3r2 A G 17: 24,641,971 V88A probably damaging Het
Slco4c1 G T 1: 96,832,110 P499H probably damaging Het
Smg1 A G 7: 118,195,133 probably benign Het
Tmem135 A G 7: 89,305,515 V98A probably benign Het
Tor4a T A 2: 25,195,906 probably null Het
Txlna A G 4: 129,630,373 F397S probably damaging Het
Tyk2 A G 9: 21,115,744 I581T probably benign Het
Unc13a C T 8: 71,662,514 D164N probably benign Het
Vwa3b T C 1: 37,114,583 I502T probably damaging Het
Xrcc6 A G 15: 82,029,218 T6A probably benign Het
Zfp524 T C 7: 5,018,433 V320A probably benign Het
Other mutations in Rspo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Rspo3 APN 10 29454152 critical splice donor site probably benign
IGL01726:Rspo3 APN 10 29504708 missense probably benign 0.40
IGL02030:Rspo3 APN 10 29500048 missense probably damaging 1.00
IGL02166:Rspo3 APN 10 29535279 missense possibly damaging 0.86
IGL03078:Rspo3 APN 10 29504661 missense probably damaging 1.00
IGL03412:Rspo3 APN 10 29535274 missense possibly damaging 0.61
R0619:Rspo3 UTSW 10 29504637 missense probably damaging 0.97
R0762:Rspo3 UTSW 10 29499921 splice site probably benign
R0831:Rspo3 UTSW 10 29454257 missense unknown
R4937:Rspo3 UTSW 10 29506528 missense probably damaging 1.00
R5031:Rspo3 UTSW 10 29506447 missense probably damaging 1.00
R6285:Rspo3 UTSW 10 29499930 critical splice donor site probably null
R6606:Rspo3 UTSW 10 29454281 missense unknown
Predicted Primers PCR Primer
(F):5'- AATATGGATCAGATTGGGAGGATTC -3'
(R):5'- AAAAGCGTTCTATGTCTGCCC -3'

Sequencing Primer
(F):5'- TCAAAGAAGCATGTTGTGTTAGTGAG -3'
(R):5'- TCTTGCCCAACTATGATAAGCAG -3'
Posted On2016-08-04