Incidental Mutation 'R5356:Nf1'
ID424116
Institutional Source Beutler Lab
Gene Symbol Nf1
Ensembl Gene ENSMUSG00000020716
Gene Nameneurofibromin 1
SynonymsNf-1, neurofibromin
MMRRC Submission 042935-MU
Accession Numbers

Genbank: NM_010897; MGI: 97306

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5356 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location79339693-79581612 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79473456 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1571 (F1571L)
Ref Sequence ENSEMBL: ENSMUSP00000071289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000108251]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071325
AA Change: F1571L

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716
AA Change: F1571L

DomainStartEndE-ValueType
RasGAP 1189 1559 2.56e-151 SMART
SEC14 1585 1737 2.36e-11 SMART
low complexity region 2619 2629 N/A INTRINSIC
low complexity region 2750 2763 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108251
AA Change: F1550L

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716
AA Change: F1550L

DomainStartEndE-ValueType
RasGAP 1189 1538 1.23e-153 SMART
SEC14 1564 1716 2.36e-11 SMART
low complexity region 2598 2608 N/A INTRINSIC
low complexity region 2729 2742 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130979
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die by day 14.5 with enlarged head and chest, pale liver, microphthalmia, cardiac defects and delayed organ development. Heterozygotes have elevated astrocyte number, predisposition to multiple tumor types and learning/memory deficits. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(16)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 C T 3: 37,065,256 T162I probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Amn1 T C 6: 149,166,894 I205M possibly damaging Het
Ankrd50 A C 3: 38,456,185 S678A probably damaging Het
Atg13 G A 2: 91,692,466 R78* probably null Het
Bmper T G 9: 23,373,861 F235L probably benign Het
Btn2a2 C T 13: 23,482,875 V187I probably benign Het
Cabs1 G A 5: 87,979,633 V48I probably benign Het
Cacnb3 A G 15: 98,641,617 I212V probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cep162 T C 9: 87,206,895 E978G probably damaging Het
Cmya5 A T 13: 93,063,485 L3445Q probably damaging Het
Cntrl T A 2: 35,148,899 L1067* probably null Het
Cyp20a1 G A 1: 60,379,387 V329I probably benign Het
Cyp2d11 A T 15: 82,390,511 N288K probably benign Het
D430041D05Rik T G 2: 104,255,409 T932P probably damaging Het
Dlk1 T A 12: 109,455,521 C54S probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Entpd6 T A 2: 150,770,383 F416L probably damaging Het
Evx1 A G 6: 52,316,617 T257A probably benign Het
Fpr-rs3 A T 17: 20,624,334 S182T probably damaging Het
Glra3 A T 8: 55,940,901 I16F probably benign Het
Gm11437 C A 11: 84,152,687 L259F possibly damaging Het
Gorasp1 A T 9: 119,927,958 L386Q probably damaging Het
Gpsm1 T C 2: 26,340,562 V508A possibly damaging Het
Gstm1 T A 3: 108,012,736 I180F probably benign Het
Hc T C 2: 34,994,995 D1400G probably benign Het
Lrp2 A G 2: 69,464,708 V3422A possibly damaging Het
Map3k4 A G 17: 12,247,308 V1128A possibly damaging Het
Mboat2 G C 12: 24,957,573 V363L probably benign Het
Mgat3 A G 15: 80,211,610 I213V possibly damaging Het
Mgat3 A G 15: 80,212,454 N494S probably damaging Het
Mtf2 A T 5: 108,106,610 T426S possibly damaging Het
Muc3a T C 5: 137,210,564 I151V probably benign Het
Myh6 T C 14: 54,953,762 E874G probably damaging Het
Myo15 G A 11: 60,498,366 G2030R probably damaging Het
Ncdn T C 4: 126,747,228 Y493C probably damaging Het
Ncoa6 A G 2: 155,421,192 F441L probably damaging Het
Ndc80 A T 17: 71,521,108 S75T possibly damaging Het
Nme8 A G 13: 19,652,299 F236L probably damaging Het
Nsmce4a C A 7: 130,537,048 V289L probably damaging Het
Ntrk2 A T 13: 59,060,242 D634V probably damaging Het
Pcsk6 G C 7: 65,970,592 E479Q probably damaging Het
Pkd1 A G 17: 24,593,577 Q3828R probably damaging Het
Ptov1 T A 7: 44,864,665 T295S probably damaging Het
Ptprf A G 4: 118,226,338 M824T probably benign Het
Rbm6 T A 9: 107,852,666 H129L probably damaging Het
Rbm8a2 A G 1: 175,978,689 I74T possibly damaging Het
Ret A G 6: 118,197,118 S6P possibly damaging Het
Rspo3 A T 10: 29,500,068 C70* probably null Het
Sike1 C A 3: 103,001,790 A202D possibly damaging Het
Slc9a3r2 A G 17: 24,641,971 V88A probably damaging Het
Slco4c1 G T 1: 96,832,110 P499H probably damaging Het
Smg1 A G 7: 118,195,133 probably benign Het
Tmem135 A G 7: 89,305,515 V98A probably benign Het
Tor4a T A 2: 25,195,906 probably null Het
Txlna A G 4: 129,630,373 F397S probably damaging Het
Tyk2 A G 9: 21,115,744 I581T probably benign Het
Unc13a C T 8: 71,662,514 D164N probably benign Het
Vwa3b T C 1: 37,114,583 I502T probably damaging Het
Xrcc6 A G 15: 82,029,218 T6A probably benign Het
Zfp524 T C 7: 5,018,433 V320A probably benign Het
Other mutations in Nf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Nf1 APN 11 79395905 missense probably damaging 0.99
IGL00801:Nf1 APN 11 79428700 splice site probably benign
IGL00823:Nf1 APN 11 79565517 missense probably damaging 1.00
IGL00945:Nf1 APN 11 79469803 missense probably damaging 0.99
IGL00960:Nf1 APN 11 79445121 missense probably damaging 1.00
IGL01118:Nf1 APN 11 79546986 missense probably damaging 0.99
IGL01604:Nf1 APN 11 79441709 splice site probably benign
IGL01637:Nf1 APN 11 79547120 missense probably damaging 1.00
IGL01659:Nf1 APN 11 79559449 missense probably benign
IGL01764:Nf1 APN 11 79384187 missense probably benign
IGL01772:Nf1 APN 11 79390249 missense probably damaging 1.00
IGL02047:Nf1 APN 11 79425535 missense probably benign 0.04
IGL02052:Nf1 APN 11 79412727 missense probably damaging 1.00
IGL02071:Nf1 APN 11 79444121 missense possibly damaging 0.96
IGL02312:Nf1 APN 11 79444648 missense possibly damaging 0.95
IGL02341:Nf1 APN 11 79564926 missense probably benign 0.33
IGL02390:Nf1 APN 11 79565935 missense possibly damaging 0.64
IGL02390:Nf1 APN 11 79411676 splice site probably benign
IGL02475:Nf1 APN 11 79535667 missense probably damaging 1.00
IGL02567:Nf1 APN 11 79547143 missense probably damaging 1.00
IGL02571:Nf1 APN 11 79428627 missense probably damaging 1.00
IGL02664:Nf1 APN 11 79444598 critical splice acceptor site probably null
IGL02664:Nf1 APN 11 79444599 critical splice acceptor site probably null
IGL02992:Nf1 APN 11 79434933 splice site probably benign
IGL03006:Nf1 APN 11 79545431 missense probably damaging 1.00
IGL03216:Nf1 APN 11 79564895 missense probably benign 0.17
Franklin UTSW 11 79473320 splice site probably null
Jefferson UTSW 11 79446864 missense probably damaging 1.00
Phyletic_dwarf UTSW 11 79454189 missense probably damaging 1.00
C9142:Nf1 UTSW 11 79556731 missense probably damaging 0.98
I2289:Nf1 UTSW 11 79547776 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0081:Nf1 UTSW 11 79453979 splice site probably benign
R0115:Nf1 UTSW 11 79468876 critical splice donor site probably null
R0144:Nf1 UTSW 11 79547127 missense probably damaging 1.00
R0196:Nf1 UTSW 11 79468769 missense possibly damaging 0.94
R0196:Nf1 UTSW 11 79578272 missense probably damaging 1.00
R0217:Nf1 UTSW 11 79428574 splice site probably benign
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0255:Nf1 UTSW 11 79408699 splice site probably null
R0362:Nf1 UTSW 11 79536878 missense probably damaging 1.00
R0364:Nf1 UTSW 11 79441957 nonsense probably null
R0464:Nf1 UTSW 11 79556789 missense probably benign 0.17
R0511:Nf1 UTSW 11 79438769 missense probably benign 0.01
R0549:Nf1 UTSW 11 79468771 missense probably damaging 0.99
R0585:Nf1 UTSW 11 79568701 missense probably damaging 0.99
R0636:Nf1 UTSW 11 79535703 missense probably damaging 0.99
R0924:Nf1 UTSW 11 79453866 missense probably damaging 0.98
R0942:Nf1 UTSW 11 79438711 missense probably benign 0.00
R1022:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1024:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1350:Nf1 UTSW 11 79412687 missense probably damaging 1.00
R1365:Nf1 UTSW 11 79547885 splice site probably null
R1395:Nf1 UTSW 11 79535983 missense possibly damaging 0.49
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1477:Nf1 UTSW 11 79395859 nonsense probably null
R1508:Nf1 UTSW 11 79440909 missense probably damaging 1.00
R1512:Nf1 UTSW 11 79390369 missense probably damaging 1.00
R1605:Nf1 UTSW 11 79440923 missense probably benign 0.01
R1680:Nf1 UTSW 11 79550998 nonsense probably null
R1704:Nf1 UTSW 11 79463301 splice site probably null
R1707:Nf1 UTSW 11 79535604 missense probably damaging 1.00
R1741:Nf1 UTSW 11 79443931 missense probably benign
R1761:Nf1 UTSW 11 79384265 missense probably damaging 1.00
R1800:Nf1 UTSW 11 79553968 missense possibly damaging 0.94
R1873:Nf1 UTSW 11 79547161 missense probably damaging 1.00
R1966:Nf1 UTSW 11 79411564 missense possibly damaging 0.72
R1967:Nf1 UTSW 11 79412745 missense probably damaging 0.96
R1970:Nf1 UTSW 11 79553961 missense probably benign 0.08
R2059:Nf1 UTSW 11 79556723 missense probably damaging 0.96
R2105:Nf1 UTSW 11 79469826 missense possibly damaging 0.50
R2151:Nf1 UTSW 11 79447570 missense possibly damaging 0.94
R2211:Nf1 UTSW 11 79444064 missense probably benign 0.39
R2497:Nf1 UTSW 11 79443884 missense probably damaging 1.00
R2899:Nf1 UTSW 11 79412758 missense possibly damaging 0.93
R3086:Nf1 UTSW 11 79546986 missense probably damaging 1.00
R3120:Nf1 UTSW 11 79564899 missense probably damaging 0.99
R3744:Nf1 UTSW 11 79548747 missense probably benign 0.23
R3801:Nf1 UTSW 11 79559521 missense probably null 0.98
R3804:Nf1 UTSW 11 79559521 missense probably null 0.98
R4212:Nf1 UTSW 11 79469798 missense probably damaging 1.00
R4298:Nf1 UTSW 11 79384244 missense probably damaging 1.00
R4578:Nf1 UTSW 11 79445759 missense probably damaging 1.00
R4579:Nf1 UTSW 11 79468757 missense probably damaging 1.00
R4587:Nf1 UTSW 11 79536037 critical splice donor site probably null
R4793:Nf1 UTSW 11 79447572 missense probably damaging 1.00
R4834:Nf1 UTSW 11 79546297 missense probably damaging 1.00
R4863:Nf1 UTSW 11 79409409 missense probably damaging 1.00
R4967:Nf1 UTSW 11 79565553 critical splice donor site probably null
R4971:Nf1 UTSW 11 79444643 missense probably damaging 1.00
R5034:Nf1 UTSW 11 79444150 missense probably damaging 0.98
R5036:Nf1 UTSW 11 79446864 missense probably damaging 1.00
R5207:Nf1 UTSW 11 79454189 missense probably damaging 1.00
R5348:Nf1 UTSW 11 79564899 missense probably damaging 1.00
R5444:Nf1 UTSW 11 79443959 missense possibly damaging 0.94
R5533:Nf1 UTSW 11 79445789 missense probably damaging 0.99
R5918:Nf1 UTSW 11 79569222 intron probably benign
R5978:Nf1 UTSW 11 79540419 missense probably damaging 1.00
R6140:Nf1 UTSW 11 79473320 splice site probably null
R6195:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6216:Nf1 UTSW 11 79411607 missense possibly damaging 0.93
R6233:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6257:Nf1 UTSW 11 79549491 missense probably damaging 1.00
R6258:Nf1 UTSW 11 79565755 intron probably null
R6756:Nf1 UTSW 11 79444587 splice site probably null
R6878:Nf1 UTSW 11 79434882 missense probably damaging 1.00
R6959:Nf1 UTSW 11 79549468 missense probably damaging 0.98
X0052:Nf1 UTSW 11 79559416 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAGGAAGGTCAGACTCCCC -3'
(R):5'- AGCAGGTGTGAATTCAGGTC -3'

Sequencing Primer
(F):5'- GGTCAGACTCCCCAATTAATGTG -3'
(R):5'- TGACTTCACACTGGCAATGG -3'
Posted On2016-08-04